FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625687_at:

>probe:Drosophila_2:1625687_at:13:175; Interrogation_Position=6810; Antisense; AATACCCGTGGAGTCGTACAAACAT
>probe:Drosophila_2:1625687_at:434:173; Interrogation_Position=6829; Antisense; AAACATGAGTATCCCGACTACGATC
>probe:Drosophila_2:1625687_at:342:53; Interrogation_Position=6898; Antisense; ATGCTGCCGCAGAGATATAATCCTT
>probe:Drosophila_2:1625687_at:87:699; Interrogation_Position=6921; Antisense; TTATCACATGGAGCACGACGCCTGG
>probe:Drosophila_2:1625687_at:284:471; Interrogation_Position=6947; Antisense; GTTCGTCCTGCGATATGGCGAATGA
>probe:Drosophila_2:1625687_at:29:369; Interrogation_Position=6966; Antisense; GAATGATTTTGCTGGCTATGCCTCT
>probe:Drosophila_2:1625687_at:562:339; Interrogation_Position=6980; Antisense; GCTATGCCTCTGTGCCACAAAGTAT
>probe:Drosophila_2:1625687_at:247:311; Interrogation_Position=6993; Antisense; GCCACAAAGTATTTCCGGATCGGTC
>probe:Drosophila_2:1625687_at:462:233; Interrogation_Position=7045; Antisense; AATCCACTACTTAGGCGGAATCAGT
>probe:Drosophila_2:1625687_at:94:239; Interrogation_Position=7113; Antisense; AATACAAGCGTTTCCAATTCGATCG
>probe:Drosophila_2:1625687_at:279:161; Interrogation_Position=7252; Antisense; ACAAGCACACATACATATCTGGCGT
>probe:Drosophila_2:1625687_at:83:23; Interrogation_Position=7266; Antisense; ATATCTGGCGTGTCATATACAAACG
>probe:Drosophila_2:1625687_at:152:127; Interrogation_Position=7329; Antisense; AGCCAACTTAACTTAGCCTTAGAAT
>probe:Drosophila_2:1625687_at:21:315; Interrogation_Position=7344; Antisense; GCCTTAGAATTGTGTTTGCCAACGT

Paste this into a BLAST search page for me
AATACCCGTGGAGTCGTACAAACATAAACATGAGTATCCCGACTACGATCATGCTGCCGCAGAGATATAATCCTTTTATCACATGGAGCACGACGCCTGGGTTCGTCCTGCGATATGGCGAATGAGAATGATTTTGCTGGCTATGCCTCTGCTATGCCTCTGTGCCACAAAGTATGCCACAAAGTATTTCCGGATCGGTCAATCCACTACTTAGGCGGAATCAGTAATACAAGCGTTTCCAATTCGATCGACAAGCACACATACATATCTGGCGTATATCTGGCGTGTCATATACAAACGAGCCAACTTAACTTAGCCTTAGAATGCCTTAGAATTGTGTTTGCCAACGT

Full Affymetrix probeset data:

Annotations for 1625687_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720