Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625688_at:

>probe:Drosophila_2:1625688_at:383:147; Interrogation_Position=1573; Antisense; ACTCAACGTTATCGGTGCTACTGGG
>probe:Drosophila_2:1625688_at:108:619; Interrogation_Position=1588; Antisense; TGCTACTGGGCACTACAATTCTCGT
>probe:Drosophila_2:1625688_at:104:625; Interrogation_Position=1696; Antisense; TGCCCCTGGGCGATGATAATGTTAA
>probe:Drosophila_2:1625688_at:196:293; Interrogation_Position=1736; Antisense; CGACTACGATTTTCCACTTGGCATG
>probe:Drosophila_2:1625688_at:604:347; Interrogation_Position=1756; Antisense; GCATGGATGCCATTCGTCGTTGGAA
>probe:Drosophila_2:1625688_at:516:369; Interrogation_Position=1778; Antisense; GAAGTGGACCTACTATATTCCGTTC
>probe:Drosophila_2:1625688_at:309:689; Interrogation_Position=1793; Antisense; TATTCCGTTCATGCCGACTTACAAG
>probe:Drosophila_2:1625688_at:457:107; Interrogation_Position=1896; Antisense; AGAAAACACTTTTCGTGCTCACGCT
>probe:Drosophila_2:1625688_at:1:293; Interrogation_Position=1909; Antisense; CGTGCTCACGCTCTAATTACAATTT
>probe:Drosophila_2:1625688_at:84:363; Interrogation_Position=1941; Antisense; GAATTCGAATGCTACCCAAAACTCT
>probe:Drosophila_2:1625688_at:598:469; Interrogation_Position=1982; Antisense; GTTCCGTGTTTCTGTTAATTTGCTT
>probe:Drosophila_2:1625688_at:331:163; Interrogation_Position=2010; Antisense; AAATTCGCTTATTGTTTGTTGCTAC
>probe:Drosophila_2:1625688_at:292:719; Interrogation_Position=2028; Antisense; TTGCTACGATTACCTAACACTCTTC
>probe:Drosophila_2:1625688_at:305:341; Interrogation_Position=2059; Antisense; GCTACCAACTCGCATATTTTCTATT

Paste this into a BLAST search page for me
ACTCAACGTTATCGGTGCTACTGGGTGCTACTGGGCACTACAATTCTCGTTGCCCCTGGGCGATGATAATGTTAACGACTACGATTTTCCACTTGGCATGGCATGGATGCCATTCGTCGTTGGAAGAAGTGGACCTACTATATTCCGTTCTATTCCGTTCATGCCGACTTACAAGAGAAAACACTTTTCGTGCTCACGCTCGTGCTCACGCTCTAATTACAATTTGAATTCGAATGCTACCCAAAACTCTGTTCCGTGTTTCTGTTAATTTGCTTAAATTCGCTTATTGTTTGTTGCTACTTGCTACGATTACCTAACACTCTTCGCTACCAACTCGCATATTTTCTATT

Full Affymetrix probeset data:

Annotations for 1625688_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime