Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625690_at:

>probe:Drosophila_2:1625690_at:10:309; Interrogation_Position=1350; Antisense; CCAGTGGCCCTTCTATCATATAGAC
>probe:Drosophila_2:1625690_at:36:273; Interrogation_Position=1366; Antisense; CATATAGACTTTCCCGATGTCCTCA
>probe:Drosophila_2:1625690_at:471:169; Interrogation_Position=1424; Antisense; AAATGGCCCATGGATTCGATAGCTA
>probe:Drosophila_2:1625690_at:65:377; Interrogation_Position=1476; Antisense; GAAGACGAACTGGTGGTCCTCAGCT
>probe:Drosophila_2:1625690_at:570:171; Interrogation_Position=1516; Antisense; AAAGAACGATATCGCTGCCTCGAAT
>probe:Drosophila_2:1625690_at:258:373; Interrogation_Position=1583; Antisense; GAAGTCTCACCTCTGGCGATAATAT
>probe:Drosophila_2:1625690_at:398:603; Interrogation_Position=1617; Antisense; TGTTGGCACTCGAATGGCATATTAC
>probe:Drosophila_2:1625690_at:717:331; Interrogation_Position=1716; Antisense; GCTGTTCTTCGTTAAGTTTGCGCAA
>probe:Drosophila_2:1625690_at:417:479; Interrogation_Position=1731; Antisense; GTTTGCGCAAACCTGGTGCAACGGC
>probe:Drosophila_2:1625690_at:416:657; Interrogation_Position=1761; Antisense; TAATGGCGATAAGCTCCGGAGACTG
>probe:Drosophila_2:1625690_at:138:615; Interrogation_Position=1784; Antisense; TGAAGACTGATGTCCACGCCTATGA
>probe:Drosophila_2:1625690_at:327:131; Interrogation_Position=1799; Antisense; ACGCCTATGATGAGTTCCGGGTTCA
>probe:Drosophila_2:1625690_at:39:25; Interrogation_Position=1838; Antisense; ATATGCCCGAGTTCAGCGAGGCTTT
>probe:Drosophila_2:1625690_at:128:195; Interrogation_Position=1871; Antisense; AACTGGGCACCGAGATGAATCCGCT

Paste this into a BLAST search page for me
CCAGTGGCCCTTCTATCATATAGACCATATAGACTTTCCCGATGTCCTCAAAATGGCCCATGGATTCGATAGCTAGAAGACGAACTGGTGGTCCTCAGCTAAAGAACGATATCGCTGCCTCGAATGAAGTCTCACCTCTGGCGATAATATTGTTGGCACTCGAATGGCATATTACGCTGTTCTTCGTTAAGTTTGCGCAAGTTTGCGCAAACCTGGTGCAACGGCTAATGGCGATAAGCTCCGGAGACTGTGAAGACTGATGTCCACGCCTATGAACGCCTATGATGAGTTCCGGGTTCAATATGCCCGAGTTCAGCGAGGCTTTAACTGGGCACCGAGATGAATCCGCT

Full Affymetrix probeset data:

Annotations for 1625690_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime