FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625691_at:

>probe:Drosophila_2:1625691_at:558:375; Interrogation_Position=1122; Antisense; GAAGACAATCGACTGACCGTCATGA
>probe:Drosophila_2:1625691_at:512:607; Interrogation_Position=1144; Antisense; TGATGGTCACCATCTTTCTGTGCTT
>probe:Drosophila_2:1625691_at:457:589; Interrogation_Position=1204; Antisense; TGGTGGACGACGAGCGCAATACCTC
>probe:Drosophila_2:1625691_at:41:69; Interrogation_Position=1260; Antisense; ATGGCCTGGGCTTCCAGTGTCATTA
>probe:Drosophila_2:1625691_at:316:267; Interrogation_Position=1274; Antisense; CAGTGTCATTAACCCGATCATCTAT
>probe:Drosophila_2:1625691_at:217:361; Interrogation_Position=1306; Antisense; GCAATCGCAACTACAGAGTGGCCTA
>probe:Drosophila_2:1625691_at:67:85; Interrogation_Position=1320; Antisense; AGAGTGGCCTACTACAAGATCTTTG
>probe:Drosophila_2:1625691_at:548:215; Interrogation_Position=1335; Antisense; AAGATCTTTGCGCTGCTCAAGTTCT
>probe:Drosophila_2:1625691_at:373:293; Interrogation_Position=1369; Antisense; CGTTGTCGCCGATGCCGAGTAGAAA
>probe:Drosophila_2:1625691_at:558:191; Interrogation_Position=1410; Antisense; AACTCCAAGGAGCTGTCGGGCGTCA
>probe:Drosophila_2:1625691_at:259:299; Interrogation_Position=1447; Antisense; CGCTGTTTCACGCTGTGCAGAAGAA
>probe:Drosophila_2:1625691_at:574:687; Interrogation_Position=1497; Antisense; TATTCAGTATGATCGAGCTCGCAGT
>probe:Drosophila_2:1625691_at:600:635; Interrogation_Position=1515; Antisense; TCGCAGTCGAGAGCTTGTAATTCAT
>probe:Drosophila_2:1625691_at:37:485; Interrogation_Position=1585; Antisense; GTATGGCCGTGCTTACATCAAAGAC

Paste this into a BLAST search page for me
GAAGACAATCGACTGACCGTCATGATGATGGTCACCATCTTTCTGTGCTTTGGTGGACGACGAGCGCAATACCTCATGGCCTGGGCTTCCAGTGTCATTACAGTGTCATTAACCCGATCATCTATGCAATCGCAACTACAGAGTGGCCTAAGAGTGGCCTACTACAAGATCTTTGAAGATCTTTGCGCTGCTCAAGTTCTCGTTGTCGCCGATGCCGAGTAGAAAAACTCCAAGGAGCTGTCGGGCGTCACGCTGTTTCACGCTGTGCAGAAGAATATTCAGTATGATCGAGCTCGCAGTTCGCAGTCGAGAGCTTGTAATTCATGTATGGCCGTGCTTACATCAAAGAC

Full Affymetrix probeset data:

Annotations for 1625691_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720