Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625695_at:

>probe:Drosophila_2:1625695_at:104:247; Interrogation_Position=1526; Antisense; AATTCGTGCGCCGACTACCAGAGAG
>probe:Drosophila_2:1625695_at:577:585; Interrogation_Position=1582; Antisense; TGGAAGATGGCCTACGCGGACCAGC
>probe:Drosophila_2:1625695_at:441:499; Interrogation_Position=1632; Antisense; GTCTGCGAGCACTGATCACTGGCCA
>probe:Drosophila_2:1625695_at:354:651; Interrogation_Position=1647; Antisense; TCACTGGCCAGCAAGCTATGCGATG
>probe:Drosophila_2:1625695_at:178:51; Interrogation_Position=1664; Antisense; ATGCGATGCCCCATTTGGACCTGGA
>probe:Drosophila_2:1625695_at:162:217; Interrogation_Position=1736; Antisense; AAGTTGCACCCCTGAACGGCAGTAC
>probe:Drosophila_2:1625695_at:575:47; Interrogation_Position=1852; Antisense; ATCCACCTGTGGCAGTTCCTCAAGG
>probe:Drosophila_2:1625695_at:285:469; Interrogation_Position=1866; Antisense; GTTCCTCAAGGAGCTGCTGGCTTCG
>probe:Drosophila_2:1625695_at:659:509; Interrogation_Position=1897; Antisense; GTGAACGGCACAGCCATCCGGTGGA
>probe:Drosophila_2:1625695_at:257:545; Interrogation_Position=1919; Antisense; GGATCGACCGAAGCAAGGGCATCTT
>probe:Drosophila_2:1625695_at:574:345; Interrogation_Position=1937; Antisense; GCATCTTCAAGATCGAGGACTCGGT
>probe:Drosophila_2:1625695_at:363:131; Interrogation_Position=1994; Antisense; ACCGACCGGCGATGAACTATGATAA
>probe:Drosophila_2:1625695_at:683:147; Interrogation_Position=2009; Antisense; ACTATGATAAGTTGTCCCGCTCCAT
>probe:Drosophila_2:1625695_at:681:297; Interrogation_Position=2026; Antisense; CGCTCCATCAGGCAGTACTACAAGA

Paste this into a BLAST search page for me
AATTCGTGCGCCGACTACCAGAGAGTGGAAGATGGCCTACGCGGACCAGCGTCTGCGAGCACTGATCACTGGCCATCACTGGCCAGCAAGCTATGCGATGATGCGATGCCCCATTTGGACCTGGAAAGTTGCACCCCTGAACGGCAGTACATCCACCTGTGGCAGTTCCTCAAGGGTTCCTCAAGGAGCTGCTGGCTTCGGTGAACGGCACAGCCATCCGGTGGAGGATCGACCGAAGCAAGGGCATCTTGCATCTTCAAGATCGAGGACTCGGTACCGACCGGCGATGAACTATGATAAACTATGATAAGTTGTCCCGCTCCATCGCTCCATCAGGCAGTACTACAAGA

Full Affymetrix probeset data:

Annotations for 1625695_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime