FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625697_at:

>probe:Drosophila_2:1625697_at:494:125; Interrogation_Position=1490; Antisense; AGCCAATTCGATCCGGAGCGTTTCT
>probe:Drosophila_2:1625697_at:457:67; Interrogation_Position=1544; Antisense; ATGGCATATCAACCCTTCGGATCTG
>probe:Drosophila_2:1625697_at:111:447; Interrogation_Position=1563; Antisense; GATCTGGGCCGCACAACTGCATTGG
>probe:Drosophila_2:1625697_at:73:319; Interrogation_Position=1590; Antisense; GCCGGATTGGCCTGCTACAGAGCAA
>probe:Drosophila_2:1625697_at:536:365; Interrogation_Position=1639; Antisense; GAATCACTCAGTGCGCAACTGCGAG
>probe:Drosophila_2:1625697_at:79:373; Interrogation_Position=1676; Antisense; GACATGAAATTCGATCCCAAGGGTT
>probe:Drosophila_2:1625697_at:132:251; Interrogation_Position=1693; Antisense; CAAGGGTTTCGTGCTCCAGGCAGAT
>probe:Drosophila_2:1625697_at:137:551; Interrogation_Position=1732; Antisense; GGAGATAGTCAACGATCGCCTCTAC
>probe:Drosophila_2:1625697_at:404:337; Interrogation_Position=1766; Antisense; GCTCCATCGCTCCAATGAATTTGAA
>probe:Drosophila_2:1625697_at:201:237; Interrogation_Position=1874; Antisense; AATCGCCTTCTGACAGCTGGCATTT
>probe:Drosophila_2:1625697_at:74:333; Interrogation_Position=1889; Antisense; GCTGGCATTTGCCTGACTTATGATG
>probe:Drosophila_2:1625697_at:187:379; Interrogation_Position=1943; Antisense; GAAGCGGCGCCTAGAGTCTACTAAA
>probe:Drosophila_2:1625697_at:666:13; Interrogation_Position=1989; Antisense; ATTACATTTAATCTGCGTGCTGAGC
>probe:Drosophila_2:1625697_at:652:117; Interrogation_Position=2014; Antisense; AGCTAGCAGCTACTCAATTGCGCCA

Paste this into a BLAST search page for me
AGCCAATTCGATCCGGAGCGTTTCTATGGCATATCAACCCTTCGGATCTGGATCTGGGCCGCACAACTGCATTGGGCCGGATTGGCCTGCTACAGAGCAAGAATCACTCAGTGCGCAACTGCGAGGACATGAAATTCGATCCCAAGGGTTCAAGGGTTTCGTGCTCCAGGCAGATGGAGATAGTCAACGATCGCCTCTACGCTCCATCGCTCCAATGAATTTGAAAATCGCCTTCTGACAGCTGGCATTTGCTGGCATTTGCCTGACTTATGATGGAAGCGGCGCCTAGAGTCTACTAAAATTACATTTAATCTGCGTGCTGAGCAGCTAGCAGCTACTCAATTGCGCCA

Full Affymetrix probeset data:

Annotations for 1625697_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720