Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625698_at:

>probe:Drosophila_2:1625698_at:715:19; Interrogation_Position=1011; Antisense; ATTTGACTTCAAATCAGGTGCCAAC
>probe:Drosophila_2:1625698_at:356:107; Interrogation_Position=1087; Antisense; AGAACTATCTGTTTGCCTACACCAA
>probe:Drosophila_2:1625698_at:574:165; Interrogation_Position=1114; Antisense; AAATCGTTCGCAGGACGTCGTTGCA
>probe:Drosophila_2:1625698_at:105:137; Interrogation_Position=1166; Antisense; ACGAGGATCAACGATACTCCACCGT
>probe:Drosophila_2:1625698_at:394:171; Interrogation_Position=1198; Antisense; AAAGTTCAGTTGCTCGTGGTAAATC
>probe:Drosophila_2:1625698_at:437:79; Interrogation_Position=1246; Antisense; AGGTCGACCAGGTTGGGCGCTAAAT
>probe:Drosophila_2:1625698_at:285:575; Interrogation_Position=1261; Antisense; GGCGCTAAATTTGAGCTGCCCAAGA
>probe:Drosophila_2:1625698_at:504:107; Interrogation_Position=1283; Antisense; AGAACATCATTTGCGCCGGAGGCGA
>probe:Drosophila_2:1625698_at:340:131; Interrogation_Position=1327; Antisense; ACCGGTGATGGAGGATCGGCCCTAT
>probe:Drosophila_2:1625698_at:96:635; Interrogation_Position=1342; Antisense; TCGGCCCTATTCTGTTCAATCGGAG
>probe:Drosophila_2:1625698_at:522:383; Interrogation_Position=1371; Antisense; GAACTCTGGTGTGTACGAGCAGGCT
>probe:Drosophila_2:1625698_at:474:349; Interrogation_Position=1425; Antisense; GCAGGAGGGCATTCCGGCCATATAT
>probe:Drosophila_2:1625698_at:168:249; Interrogation_Position=1471; Antisense; AATTGGATTACCGAGAAGCTGCTGC
>probe:Drosophila_2:1625698_at:555:203; Interrogation_Position=1486; Antisense; AAGCTGCTGCCCTTCGATTACAGGA

Paste this into a BLAST search page for me
ATTTGACTTCAAATCAGGTGCCAACAGAACTATCTGTTTGCCTACACCAAAAATCGTTCGCAGGACGTCGTTGCAACGAGGATCAACGATACTCCACCGTAAAGTTCAGTTGCTCGTGGTAAATCAGGTCGACCAGGTTGGGCGCTAAATGGCGCTAAATTTGAGCTGCCCAAGAAGAACATCATTTGCGCCGGAGGCGAACCGGTGATGGAGGATCGGCCCTATTCGGCCCTATTCTGTTCAATCGGAGGAACTCTGGTGTGTACGAGCAGGCTGCAGGAGGGCATTCCGGCCATATATAATTGGATTACCGAGAAGCTGCTGCAAGCTGCTGCCCTTCGATTACAGGA

Full Affymetrix probeset data:

Annotations for 1625698_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime