Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625702_s_at:

>probe:Drosophila_2:1625702_s_at:519:163; Interrogation_Position=1018; Antisense; AAATTATCGTCGCTCTATTGTAGAT
>probe:Drosophila_2:1625702_s_at:528:523; Interrogation_Position=518; Antisense; GGGCCCCATATCTGGTGGTAGCAAG
>probe:Drosophila_2:1625702_s_at:260:487; Interrogation_Position=535; Antisense; GTAGCAAGTCATCCAATCACACATC
>probe:Drosophila_2:1625702_s_at:401:417; Interrogation_Position=612; Antisense; GAGCTCGTCCGAGAGGTGGATACCA
>probe:Drosophila_2:1625702_s_at:300:435; Interrogation_Position=651; Antisense; GAGGATGTTGAGGAGCTTCTGCTTC
>probe:Drosophila_2:1625702_s_at:92:713; Interrogation_Position=667; Antisense; TTCTGCTTCAGATCATCGACGACTT
>probe:Drosophila_2:1625702_s_at:544:135; Interrogation_Position=685; Antisense; ACGACTTTGTCGAGGACACCGTCAA
>probe:Drosophila_2:1625702_s_at:226:161; Interrogation_Position=745; Antisense; ACAAGATCGAGGTGCGCGACGTGCA
>probe:Drosophila_2:1625702_s_at:465:509; Interrogation_Position=765; Antisense; GTGCAGCTGCACTTTGAGCGGAAGT
>probe:Drosophila_2:1625702_s_at:21:491; Interrogation_Position=788; Antisense; GTACAACATGTGGATACCCGGCTTC
>probe:Drosophila_2:1625702_s_at:442:353; Interrogation_Position=843; Antisense; GCAGCTGTCACGGAGGCGCACAAAC
>probe:Drosophila_2:1625702_s_at:312:313; Interrogation_Position=871; Antisense; GCCTTGCCCTCATACGGAAAACGAT
>probe:Drosophila_2:1625702_s_at:183:39; Interrogation_Position=917; Antisense; ATCTAATCGGGTCGAGGCTCTGTTT
>probe:Drosophila_2:1625702_s_at:318:689; Interrogation_Position=945; Antisense; TTTGCCGGATTTCGCGTATGCTAAA

Paste this into a BLAST search page for me
AAATTATCGTCGCTCTATTGTAGATGGGCCCCATATCTGGTGGTAGCAAGGTAGCAAGTCATCCAATCACACATCGAGCTCGTCCGAGAGGTGGATACCAGAGGATGTTGAGGAGCTTCTGCTTCTTCTGCTTCAGATCATCGACGACTTACGACTTTGTCGAGGACACCGTCAAACAAGATCGAGGTGCGCGACGTGCAGTGCAGCTGCACTTTGAGCGGAAGTGTACAACATGTGGATACCCGGCTTCGCAGCTGTCACGGAGGCGCACAAACGCCTTGCCCTCATACGGAAAACGATATCTAATCGGGTCGAGGCTCTGTTTTTTGCCGGATTTCGCGTATGCTAAA

Full Affymetrix probeset data:

Annotations for 1625702_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime