FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625704_at:

>probe:Drosophila_2:1625704_at:67:645; Interrogation_Position=1331; Antisense; TCTACGGCAGCAGCCTGTTGCAGAG
>probe:Drosophila_2:1625704_at:626:603; Interrogation_Position=1346; Antisense; TGTTGCAGAGCCTCAGCTATCCAAC
>probe:Drosophila_2:1625704_at:193:203; Interrogation_Position=1416; Antisense; AACCACATCAGCTCCTGGCAAGATG
>probe:Drosophila_2:1625704_at:92:97; Interrogation_Position=1484; Antisense; AGATCAAGACCTCACCGGATAGCTT
>probe:Drosophila_2:1625704_at:143:291; Interrogation_Position=1499; Antisense; CGGATAGCTTGTTGCGGGCACGCAC
>probe:Drosophila_2:1625704_at:340:353; Interrogation_Position=1567; Antisense; GCAGCTCACACTCCGATTAATCTAA
>probe:Drosophila_2:1625704_at:548:695; Interrogation_Position=1604; Antisense; TTTCTAGCCTTAAAACCGGACATGC
>probe:Drosophila_2:1625704_at:179:369; Interrogation_Position=1718; Antisense; GAATGCCGCCTGTGGAGCTATCCTT
>probe:Drosophila_2:1625704_at:573:143; Interrogation_Position=1746; Antisense; ACTGCCGCCTTTGGATTTGGAGCGA
>probe:Drosophila_2:1625704_at:581:729; Interrogation_Position=1762; Antisense; TTGGAGCGATTGAAGCCCATCACCT
>probe:Drosophila_2:1625704_at:672:271; Interrogation_Position=1779; Antisense; CATCACCTCGACATACTTGCAGTTG
>probe:Drosophila_2:1625704_at:363:467; Interrogation_Position=1800; Antisense; GTTGACACGCAGCATGGGACTCAGC
>probe:Drosophila_2:1625704_at:251:57; Interrogation_Position=1826; Antisense; ATGAGGATGCCTTGCGGTTCGACAA
>probe:Drosophila_2:1625704_at:342:657; Interrogation_Position=1860; Antisense; TAAGGACTTCAAGTACTCGCTGTAG

Paste this into a BLAST search page for me
TCTACGGCAGCAGCCTGTTGCAGAGTGTTGCAGAGCCTCAGCTATCCAACAACCACATCAGCTCCTGGCAAGATGAGATCAAGACCTCACCGGATAGCTTCGGATAGCTTGTTGCGGGCACGCACGCAGCTCACACTCCGATTAATCTAATTTCTAGCCTTAAAACCGGACATGCGAATGCCGCCTGTGGAGCTATCCTTACTGCCGCCTTTGGATTTGGAGCGATTGGAGCGATTGAAGCCCATCACCTCATCACCTCGACATACTTGCAGTTGGTTGACACGCAGCATGGGACTCAGCATGAGGATGCCTTGCGGTTCGACAATAAGGACTTCAAGTACTCGCTGTAG

Full Affymetrix probeset data:

Annotations for 1625704_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720