Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625705_s_at:

>probe:Drosophila_2:1625705_s_at:718:649; Interrogation_Position=124; Antisense; TCAGCCAGAGCTCCCGAGGATCAAG
>probe:Drosophila_2:1625705_s_at:488:501; Interrogation_Position=15; Antisense; GTCGTCGACACATTTGCTGCATTCA
>probe:Drosophila_2:1625705_s_at:236:233; Interrogation_Position=261; Antisense; AATCCTCACTAGCAGTAGCACTACG
>probe:Drosophila_2:1625705_s_at:75:91; Interrogation_Position=274; Antisense; AGTAGCACTACGTCTTCGGCCAGGG
>probe:Drosophila_2:1625705_s_at:572:335; Interrogation_Position=30; Antisense; GCTGCATTCACTGTCACTGTTGTTG
>probe:Drosophila_2:1625705_s_at:203:659; Interrogation_Position=320; Antisense; TAACCAGCTGGCAGAGCAGCCACAG
>probe:Drosophila_2:1625705_s_at:596:143; Interrogation_Position=45; Antisense; ACTGTTGTTGCTACCACTGCGTTGT
>probe:Drosophila_2:1625705_s_at:569:485; Interrogation_Position=473; Antisense; GTAGAGGAGCCAACACAACGCCGAC
>probe:Drosophila_2:1625705_s_at:235:431; Interrogation_Position=507; Antisense; GAGTAGATCCTCCAGAATCCAAATT
>probe:Drosophila_2:1625705_s_at:516:13; Interrogation_Position=529; Antisense; ATTAGCAGTTGCAGCACTAGTCCTG
>probe:Drosophila_2:1625705_s_at:88:143; Interrogation_Position=557; Antisense; ACTGCAGTTGGACCGCCGGAGCAAT
>probe:Drosophila_2:1625705_s_at:95:553; Interrogation_Position=574; Antisense; GGAGCAATCGTAGCCTCCTTAGCAT
>probe:Drosophila_2:1625705_s_at:8:145; Interrogation_Position=60; Antisense; ACTGCGTTGTCGTCGTAATTGCCAC
>probe:Drosophila_2:1625705_s_at:214:653; Interrogation_Position=75; Antisense; TAATTGCCACCAGATCGTTTCCTTG

Paste this into a BLAST search page for me
TCAGCCAGAGCTCCCGAGGATCAAGGTCGTCGACACATTTGCTGCATTCAAATCCTCACTAGCAGTAGCACTACGAGTAGCACTACGTCTTCGGCCAGGGGCTGCATTCACTGTCACTGTTGTTGTAACCAGCTGGCAGAGCAGCCACAGACTGTTGTTGCTACCACTGCGTTGTGTAGAGGAGCCAACACAACGCCGACGAGTAGATCCTCCAGAATCCAAATTATTAGCAGTTGCAGCACTAGTCCTGACTGCAGTTGGACCGCCGGAGCAATGGAGCAATCGTAGCCTCCTTAGCATACTGCGTTGTCGTCGTAATTGCCACTAATTGCCACCAGATCGTTTCCTTG

Full Affymetrix probeset data:

Annotations for 1625705_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime