FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625706_at:

>probe:Drosophila_2:1625706_at:298:691; Interrogation_Position=1009; Antisense; TTTGTTTACTTTATATCCCTCTCCG
>probe:Drosophila_2:1625706_at:468:171; Interrogation_Position=1120; Antisense; AAAGTGCGCGCACACATGCAGAAAA
>probe:Drosophila_2:1625706_at:661:209; Interrogation_Position=585; Antisense; AAGCACGCGGACGAGATTCTGACCA
>probe:Drosophila_2:1625706_at:111:429; Interrogation_Position=597; Antisense; GAGATTCTGACCATCGCCGACGAGG
>probe:Drosophila_2:1625706_at:386:439; Interrogation_Position=618; Antisense; GAGGCAGCGGCCATCAAGCACATAG
>probe:Drosophila_2:1625706_at:233:25; Interrogation_Position=639; Antisense; ATAGTCCGCACCCTGGTCAGCGTGT
>probe:Drosophila_2:1625706_at:213:67; Interrogation_Position=684; Antisense; ATGGAGGTGGCTGTGCTCAAGTACC
>probe:Drosophila_2:1625706_at:552:313; Interrogation_Position=709; Antisense; GCCAGCCACTGCGTATGATTGATCA
>probe:Drosophila_2:1625706_at:699:305; Interrogation_Position=859; Antisense; CCTGGCCATTTTCATGACCAATCAA
>probe:Drosophila_2:1625706_at:454:93; Interrogation_Position=885; Antisense; AGTTGATAACCGGTCGTGCTCTCTT
>probe:Drosophila_2:1625706_at:558:321; Interrogation_Position=902; Antisense; GCTCTCTTTTTCTGGGCAATTCAAT
>probe:Drosophila_2:1625706_at:715:639; Interrogation_Position=912; Antisense; TCTGGGCAATTCAATTTCGGCCGGG
>probe:Drosophila_2:1625706_at:563:239; Interrogation_Position=982; Antisense; AATCACTTAATTTGTCTCCAGGGCG
>probe:Drosophila_2:1625706_at:392:497; Interrogation_Position=995; Antisense; GTCTCCAGGGCGTATTTGTTTACTT

Paste this into a BLAST search page for me
TTTGTTTACTTTATATCCCTCTCCGAAAGTGCGCGCACACATGCAGAAAAAAGCACGCGGACGAGATTCTGACCAGAGATTCTGACCATCGCCGACGAGGGAGGCAGCGGCCATCAAGCACATAGATAGTCCGCACCCTGGTCAGCGTGTATGGAGGTGGCTGTGCTCAAGTACCGCCAGCCACTGCGTATGATTGATCACCTGGCCATTTTCATGACCAATCAAAGTTGATAACCGGTCGTGCTCTCTTGCTCTCTTTTTCTGGGCAATTCAATTCTGGGCAATTCAATTTCGGCCGGGAATCACTTAATTTGTCTCCAGGGCGGTCTCCAGGGCGTATTTGTTTACTT

Full Affymetrix probeset data:

Annotations for 1625706_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720