Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625707_s_at:

>probe:Drosophila_2:1625707_s_at:599:89; Interrogation_Position=259; Antisense; AGTACCGCTTCTCCTACGGAGTCGA
>probe:Drosophila_2:1625707_s_at:102:133; Interrogation_Position=262; Antisense; ACCGCTTCTCCTACGGAGTCGATGA
>probe:Drosophila_2:1625707_s_at:726:341; Interrogation_Position=265; Antisense; GCTTCTCCTACGGAGTCGATGACAA
>probe:Drosophila_2:1625707_s_at:387:643; Interrogation_Position=268; Antisense; TCTCCTACGGAGTCGATGACAAGCT
>probe:Drosophila_2:1625707_s_at:535:629; Interrogation_Position=270; Antisense; TCCTACGGAGTCGATGACAAGCTAA
>probe:Drosophila_2:1625707_s_at:150:431; Interrogation_Position=277; Antisense; GAGTCGATGACAAGCTAACCGGTGA
>probe:Drosophila_2:1625707_s_at:401:637; Interrogation_Position=280; Antisense; TCGATGACAAGCTAACCGGTGACAA
>probe:Drosophila_2:1625707_s_at:492:53; Interrogation_Position=283; Antisense; ATGACAAGCTAACCGGTGACAACAA
>probe:Drosophila_2:1625707_s_at:595:251; Interrogation_Position=287; Antisense; CAAGCTAACCGGTGACAACAAGGGA
>probe:Drosophila_2:1625707_s_at:59:279; Interrogation_Position=291; Antisense; CTAACCGGTGACAACAAGGGACAGG
>probe:Drosophila_2:1625707_s_at:214:437; Interrogation_Position=318; Antisense; GAGGAGCGCGATGGAGATGTGGTAC
>probe:Drosophila_2:1625707_s_at:666:43; Interrogation_Position=360; Antisense; ATCGACGCTGACGGCTACAAGAGGA
>probe:Drosophila_2:1625707_s_at:178:537; Interrogation_Position=590; Antisense; GGTCAAGACTGTGGCCCCAGTGGCT
>probe:Drosophila_2:1625707_s_at:235:297; Interrogation_Position=629; Antisense; CGCTGCATATGCCACCTATGCTGCT

Paste this into a BLAST search page for me
AGTACCGCTTCTCCTACGGAGTCGAACCGCTTCTCCTACGGAGTCGATGAGCTTCTCCTACGGAGTCGATGACAATCTCCTACGGAGTCGATGACAAGCTTCCTACGGAGTCGATGACAAGCTAAGAGTCGATGACAAGCTAACCGGTGATCGATGACAAGCTAACCGGTGACAAATGACAAGCTAACCGGTGACAACAACAAGCTAACCGGTGACAACAAGGGACTAACCGGTGACAACAAGGGACAGGGAGGAGCGCGATGGAGATGTGGTACATCGACGCTGACGGCTACAAGAGGAGGTCAAGACTGTGGCCCCAGTGGCTCGCTGCATATGCCACCTATGCTGCT

Full Affymetrix probeset data:

Annotations for 1625707_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime