FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625710_at:

>probe:Drosophila_2:1625710_at:3:237; Interrogation_Position=238; Antisense; AATCGCCTGGTTTGTCTCATGGATC
>probe:Drosophila_2:1625710_at:45:713; Interrogation_Position=266; Antisense; TTCATCTGGTTGCTCAGCTCGAAGA
>probe:Drosophila_2:1625710_at:625:217; Interrogation_Position=306; Antisense; AAGTCAATATGCTCTTCGGCCTGAT
>probe:Drosophila_2:1625710_at:293:717; Interrogation_Position=320; Antisense; TTCGGCCTGATACTCGACGTAGTGA
>probe:Drosophila_2:1625710_at:280:137; Interrogation_Position=336; Antisense; ACGTAGTGATCGTGGCCGTGCTGAA
>probe:Drosophila_2:1625710_at:323:543; Interrogation_Position=397; Antisense; GGATATGCTGACCATTGGACCCGAT
>probe:Drosophila_2:1625710_at:499:455; Interrogation_Position=419; Antisense; GATAAGTTCAGCTTTCCCTCAGGTC
>probe:Drosophila_2:1625710_at:183:121; Interrogation_Position=483; Antisense; AGCTGTATCCGCTTCACATCATATT
>probe:Drosophila_2:1625710_at:671:35; Interrogation_Position=500; Antisense; ATCATATTCCTAATGCCGGTCACAG
>probe:Drosophila_2:1625710_at:683:263; Interrogation_Position=522; Antisense; CAGCTTGGGCTGTAAGCGTGGCCAT
>probe:Drosophila_2:1625710_at:453:647; Interrogation_Position=555; Antisense; TCATCCTCCAGCGTCATTATATTTT
>probe:Drosophila_2:1625710_at:40:21; Interrogation_Position=573; Antisense; ATATTTTGGATATCTGCGCCGGTGC
>probe:Drosophila_2:1625710_at:532:237; Interrogation_Position=622; Antisense; AATCGTGGGACTTCTGTGGATCAGC
>probe:Drosophila_2:1625710_at:690:343; Interrogation_Position=663; Antisense; GCATTGTGGGCTTTGTTACCGAGGA

Paste this into a BLAST search page for me
AATCGCCTGGTTTGTCTCATGGATCTTCATCTGGTTGCTCAGCTCGAAGAAAGTCAATATGCTCTTCGGCCTGATTTCGGCCTGATACTCGACGTAGTGAACGTAGTGATCGTGGCCGTGCTGAAGGATATGCTGACCATTGGACCCGATGATAAGTTCAGCTTTCCCTCAGGTCAGCTGTATCCGCTTCACATCATATTATCATATTCCTAATGCCGGTCACAGCAGCTTGGGCTGTAAGCGTGGCCATTCATCCTCCAGCGTCATTATATTTTATATTTTGGATATCTGCGCCGGTGCAATCGTGGGACTTCTGTGGATCAGCGCATTGTGGGCTTTGTTACCGAGGA

Full Affymetrix probeset data:

Annotations for 1625710_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720