FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625712_at:

>probe:Drosophila_2:1625712_at:46:231; Interrogation_Position=1048; Antisense; AATGTAGCGACAGCTCTGAATCTAA
>probe:Drosophila_2:1625712_at:730:365; Interrogation_Position=1065; Antisense; GAATCTAAGAGCTACCGTATGCAAA
>probe:Drosophila_2:1625712_at:118:331; Interrogation_Position=499; Antisense; GCGGTGGTGTCCATCTCACAGTGGC
>probe:Drosophila_2:1625712_at:354:153; Interrogation_Position=613; Antisense; ACATCCTGCTGACGGCCAACGTGAG
>probe:Drosophila_2:1625712_at:216:197; Interrogation_Position=630; Antisense; AACGTGAGCACCATCCGGCACCAGA
>probe:Drosophila_2:1625712_at:90:265; Interrogation_Position=651; Antisense; CAGACCTGCCGCATGATCTACAGGT
>probe:Drosophila_2:1625712_at:157:59; Interrogation_Position=663; Antisense; ATGATCTACAGGTCCGGCCTGCTGC
>probe:Drosophila_2:1625712_at:58:83; Interrogation_Position=715; Antisense; AGGGCGGCACCGATTCTTGTCAAGG
>probe:Drosophila_2:1625712_at:255:463; Interrogation_Position=726; Antisense; GATTCTTGTCAAGGCGACTCCGGCG
>probe:Drosophila_2:1625712_at:527:517; Interrogation_Position=834; Antisense; GTGGACGTGGAGTACTACCGCCAGT
>probe:Drosophila_2:1625712_at:340:673; Interrogation_Position=849; Antisense; TACCGCCAGTGGATAGAGGGACGCA
>probe:Drosophila_2:1625712_at:373:7; Interrogation_Position=886; Antisense; ATTCCAGGCTGGCTACCGGACTGTT
>probe:Drosophila_2:1625712_at:256:521; Interrogation_Position=953; Antisense; GTGGCTATAGCCACCATTTCGGCAT
>probe:Drosophila_2:1625712_at:79:49; Interrogation_Position=976; Antisense; ATCCATGCCAGTGCTTTAGTCTATG

Paste this into a BLAST search page for me
AATGTAGCGACAGCTCTGAATCTAAGAATCTAAGAGCTACCGTATGCAAAGCGGTGGTGTCCATCTCACAGTGGCACATCCTGCTGACGGCCAACGTGAGAACGTGAGCACCATCCGGCACCAGACAGACCTGCCGCATGATCTACAGGTATGATCTACAGGTCCGGCCTGCTGCAGGGCGGCACCGATTCTTGTCAAGGGATTCTTGTCAAGGCGACTCCGGCGGTGGACGTGGAGTACTACCGCCAGTTACCGCCAGTGGATAGAGGGACGCAATTCCAGGCTGGCTACCGGACTGTTGTGGCTATAGCCACCATTTCGGCATATCCATGCCAGTGCTTTAGTCTATG

Full Affymetrix probeset data:

Annotations for 1625712_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720