FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625713_at:

>probe:Drosophila_2:1625713_at:56:529; Interrogation_Position=1014; Antisense; GGGACTTGCATGATATGCTCTCTTA
>probe:Drosophila_2:1625713_at:517:27; Interrogation_Position=513; Antisense; ATACCTTTGTGGCTGTATGCCTGAG
>probe:Drosophila_2:1625713_at:224:109; Interrogation_Position=548; Antisense; AGAATTCCGTACACCTTGCCAGAGG
>probe:Drosophila_2:1625713_at:551:99; Interrogation_Position=568; Antisense; AGAGGCTATATCTCTCGTCTTCGGA
>probe:Drosophila_2:1625713_at:468:637; Interrogation_Position=582; Antisense; TCGTCTTCGGACTACCCATGGAGAA
>probe:Drosophila_2:1625713_at:127:609; Interrogation_Position=622; Antisense; TGAGTCGCAGCGTAACTTCACTGCT
>probe:Drosophila_2:1625713_at:384:29; Interrogation_Position=673; Antisense; ATACTTGGCCAAGTTGGTCCAGCTT
>probe:Drosophila_2:1625713_at:386:505; Interrogation_Position=689; Antisense; GTCCAGCTTCAACACATAATGCACG
>probe:Drosophila_2:1625713_at:72:703; Interrogation_Position=724; Antisense; TTATAGTCACATCTTTTGCGCCGAG
>probe:Drosophila_2:1625713_at:307:287; Interrogation_Position=742; Antisense; CGCCGAGGTTTATCGCATATCCTTA
>probe:Drosophila_2:1625713_at:468:23; Interrogation_Position=758; Antisense; ATATCCTTAGAGTTCAGCCACAGCT
>probe:Drosophila_2:1625713_at:144:67; Interrogation_Position=818; Antisense; ATGGCACCTGCCAGTAGCTTCGGGT
>probe:Drosophila_2:1625713_at:702:115; Interrogation_Position=833; Antisense; AGCTTCGGGTTCCAACTCTTAGATT
>probe:Drosophila_2:1625713_at:352:117; Interrogation_Position=956; Antisense; AGCTTCTGCTGATATGTGTCTCATA

Paste this into a BLAST search page for me
GGGACTTGCATGATATGCTCTCTTAATACCTTTGTGGCTGTATGCCTGAGAGAATTCCGTACACCTTGCCAGAGGAGAGGCTATATCTCTCGTCTTCGGATCGTCTTCGGACTACCCATGGAGAATGAGTCGCAGCGTAACTTCACTGCTATACTTGGCCAAGTTGGTCCAGCTTGTCCAGCTTCAACACATAATGCACGTTATAGTCACATCTTTTGCGCCGAGCGCCGAGGTTTATCGCATATCCTTAATATCCTTAGAGTTCAGCCACAGCTATGGCACCTGCCAGTAGCTTCGGGTAGCTTCGGGTTCCAACTCTTAGATTAGCTTCTGCTGATATGTGTCTCATA

Full Affymetrix probeset data:

Annotations for 1625713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720