Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625714_a_at:

>probe:Drosophila_2:1625714_a_at:355:305; Interrogation_Position=104; Antisense; CCGTGCCCACGACAAAGATTTTCTA
>probe:Drosophila_2:1625714_a_at:468:459; Interrogation_Position=120; Antisense; GATTTTCTATCCCTTCTTCGTTTTG
>probe:Drosophila_2:1625714_a_at:464:713; Interrogation_Position=148; Antisense; TTCTACGTGCTGTCAGTTCTTCCAG
>probe:Drosophila_2:1625714_a_at:535:273; Interrogation_Position=166; Antisense; CTTCCAGTCTTCATTGCCAGGAGGA
>probe:Drosophila_2:1625714_a_at:555:395; Interrogation_Position=216; Antisense; GAAATCGGAGTTTGCTCACTTCCTT
>probe:Drosophila_2:1625714_a_at:249:721; Interrogation_Position=295; Antisense; TTGGTGATCACCTGGACGGCGAGTA
>probe:Drosophila_2:1625714_a_at:126:689; Interrogation_Position=342; Antisense; TATTAACTACGGCACCATCTTCTGG
>probe:Drosophila_2:1625714_a_at:622:415; Interrogation_Position=385; Antisense; GAGCCATACGGATCCATGTTCTAGA
>probe:Drosophila_2:1625714_a_at:378:259; Interrogation_Position=432; Antisense; CACTAGGCTAGTAACCGGCGCAGGA
>probe:Drosophila_2:1625714_a_at:202:243; Interrogation_Position=456; Antisense; AATATCACCGATGCACTGGGTCCTA
>probe:Drosophila_2:1625714_a_at:438:579; Interrogation_Position=488; Antisense; GGCCATTTATCCGTAAGCACGCATG
>probe:Drosophila_2:1625714_a_at:516:341; Interrogation_Position=519; Antisense; GCTTATCCGCAGTCATCAACAAATC
>probe:Drosophila_2:1625714_a_at:518:39; Interrogation_Position=52; Antisense; ATCTGCGCCTTTCTTACATGCATTG
>probe:Drosophila_2:1625714_a_at:160:53; Interrogation_Position=69; Antisense; ATGCATTGGTGTTACCTTCCTGATC

Paste this into a BLAST search page for me
CCGTGCCCACGACAAAGATTTTCTAGATTTTCTATCCCTTCTTCGTTTTGTTCTACGTGCTGTCAGTTCTTCCAGCTTCCAGTCTTCATTGCCAGGAGGAGAAATCGGAGTTTGCTCACTTCCTTTTGGTGATCACCTGGACGGCGAGTATATTAACTACGGCACCATCTTCTGGGAGCCATACGGATCCATGTTCTAGACACTAGGCTAGTAACCGGCGCAGGAAATATCACCGATGCACTGGGTCCTAGGCCATTTATCCGTAAGCACGCATGGCTTATCCGCAGTCATCAACAAATCATCTGCGCCTTTCTTACATGCATTGATGCATTGGTGTTACCTTCCTGATC

Full Affymetrix probeset data:

Annotations for 1625714_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime