Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625717_s_at:

>probe:Drosophila_2:1625717_s_at:372:521; Interrogation_Position=163; Antisense; GTGGCCACCAACAAGTACGCGGTAT
>probe:Drosophila_2:1625717_s_at:50:411; Interrogation_Position=222; Antisense; GACGCTCTCCAAGCCGCAAGGATAT
>probe:Drosophila_2:1625717_s_at:353:665; Interrogation_Position=271; Antisense; TACAACACGGGTCCGCTGATGGGCA
>probe:Drosophila_2:1625717_s_at:290:593; Interrogation_Position=323; Antisense; TGGTGGCCACAAATGCGCGCGGCAA
>probe:Drosophila_2:1625717_s_at:163:239; Interrogation_Position=357; Antisense; AATCAACTACCTGATCGGCGGTTTT
>probe:Drosophila_2:1625717_s_at:236:573; Interrogation_Position=391; Antisense; GGCGTCTTTGGAGCCTGGAAACACA
>probe:Drosophila_2:1625717_s_at:557:185; Interrogation_Position=410; Antisense; AACACAACCACGTAGCTGGTCTGTG
>probe:Drosophila_2:1625717_s_at:661:593; Interrogation_Position=449; Antisense; TGGGCATCGCTGGTGTCATCAAGAA
>probe:Drosophila_2:1625717_s_at:396:527; Interrogation_Position=494; Antisense; GGGAGTTCTTCCCAAACACACCGAT
>probe:Drosophila_2:1625717_s_at:175:593; Interrogation_Position=528; Antisense; TGGTGGTCTGAACATTGCCGGAAAC
>probe:Drosophila_2:1625717_s_at:156:625; Interrogation_Position=543; Antisense; TGCCGGAAACGACTGGACCATCATG
>probe:Drosophila_2:1625717_s_at:25:65; Interrogation_Position=616; Antisense; AGGCGTAAAGTCTAGTTTCCTATGT
>probe:Drosophila_2:1625717_s_at:61:393; Interrogation_Position=666; Antisense; GAAAGATTCGGCACTAACCGCTTGC
>probe:Drosophila_2:1625717_s_at:628:201; Interrogation_Position=681; Antisense; AACCGCTTGCCTTGCAACCGAATAA

Paste this into a BLAST search page for me
GTGGCCACCAACAAGTACGCGGTATGACGCTCTCCAAGCCGCAAGGATATTACAACACGGGTCCGCTGATGGGCATGGTGGCCACAAATGCGCGCGGCAAAATCAACTACCTGATCGGCGGTTTTGGCGTCTTTGGAGCCTGGAAACACAAACACAACCACGTAGCTGGTCTGTGTGGGCATCGCTGGTGTCATCAAGAAGGGAGTTCTTCCCAAACACACCGATTGGTGGTCTGAACATTGCCGGAAACTGCCGGAAACGACTGGACCATCATGAGGCGTAAAGTCTAGTTTCCTATGTGAAAGATTCGGCACTAACCGCTTGCAACCGCTTGCCTTGCAACCGAATAA

Full Affymetrix probeset data:

Annotations for 1625717_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime