FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625720_at:

>probe:Drosophila_2:1625720_at:667:423; Interrogation_Position=1023; Antisense; GAGGAGTCCCATGCCGGAAAGGTAC
>probe:Drosophila_2:1625720_at:718:217; Interrogation_Position=1164; Antisense; AAGTAGTGCTTAGGGCAGTTTCTGC
>probe:Drosophila_2:1625720_at:398:265; Interrogation_Position=1179; Antisense; CAGTTTCTGCCCGAATAATTGTACA
>probe:Drosophila_2:1625720_at:416:225; Interrogation_Position=711; Antisense; AAGGACGAGGACATCTCCATCACGT
>probe:Drosophila_2:1625720_at:399:33; Interrogation_Position=729; Antisense; ATCACGTTCAGCTACTGGGATGGCT
>probe:Drosophila_2:1625720_at:651:613; Interrogation_Position=778; Antisense; TGAAGAAGGGCAACTCCATCTACCA
>probe:Drosophila_2:1625720_at:424:145; Interrogation_Position=790; Antisense; ACTCCATCTACCAGTTTCTGCAGAA
>probe:Drosophila_2:1625720_at:309:479; Interrogation_Position=803; Antisense; GTTTCTGCAGAAGTGCCTGGAGCTG
>probe:Drosophila_2:1625720_at:126:195; Interrogation_Position=847; Antisense; AACTGAAGACCGTAATGGCCGACCA
>probe:Drosophila_2:1625720_at:572:581; Interrogation_Position=862; Antisense; TGGCCGACCAGCTGATGTACGTCAA
>probe:Drosophila_2:1625720_at:137:257; Interrogation_Position=909; Antisense; CACTATTCCTTCTACGACTTTATCG
>probe:Drosophila_2:1625720_at:484:401; Interrogation_Position=924; Antisense; GACTTTATCGTGACCAAGGCACGCG
>probe:Drosophila_2:1625720_at:581:407; Interrogation_Position=975; Antisense; GACGTCCACGACGATGTGCGCATGA
>probe:Drosophila_2:1625720_at:250:347; Interrogation_Position=994; Antisense; GCATGATAAGCGACGCCTCCGTGGA

Paste this into a BLAST search page for me
GAGGAGTCCCATGCCGGAAAGGTACAAGTAGTGCTTAGGGCAGTTTCTGCCAGTTTCTGCCCGAATAATTGTACAAAGGACGAGGACATCTCCATCACGTATCACGTTCAGCTACTGGGATGGCTTGAAGAAGGGCAACTCCATCTACCAACTCCATCTACCAGTTTCTGCAGAAGTTTCTGCAGAAGTGCCTGGAGCTGAACTGAAGACCGTAATGGCCGACCATGGCCGACCAGCTGATGTACGTCAACACTATTCCTTCTACGACTTTATCGGACTTTATCGTGACCAAGGCACGCGGACGTCCACGACGATGTGCGCATGAGCATGATAAGCGACGCCTCCGTGGA

Full Affymetrix probeset data:

Annotations for 1625720_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720