Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625721_s_at:

>probe:Drosophila_2:1625721_s_at:388:35; Interrogation_Position=103; Antisense; ATCAGCCACCACGAGGTGATGAAAC
>probe:Drosophila_2:1625721_s_at:422:309; Interrogation_Position=108; Antisense; CCACCACGAGGTGATGAAACTGATG
>probe:Drosophila_2:1625721_s_at:74:67; Interrogation_Position=13; Antisense; ATGGAACTCCTTCCTCTGAAGTCGC
>probe:Drosophila_2:1625721_s_at:703:583; Interrogation_Position=14; Antisense; TGGAACTCCTTCCTCTGAAGTCGCC
>probe:Drosophila_2:1625721_s_at:43:447; Interrogation_Position=45; Antisense; GATCCTGCTCCTATGCCTAACCATT
>probe:Drosophila_2:1625721_s_at:48:683; Interrogation_Position=56; Antisense; TATGCCTAACCATTTCCACTTCGGT
>probe:Drosophila_2:1625721_s_at:38:659; Interrogation_Position=62; Antisense; TAACCATTTCCACTTCGGTCAGCGG
>probe:Drosophila_2:1625721_s_at:467:19; Interrogation_Position=67; Antisense; ATTTCCACTTCGGTCAGCGGCTATC
>probe:Drosophila_2:1625721_s_at:344:629; Interrogation_Position=70; Antisense; TCCACTTCGGTCAGCGGCTATCTGA
>probe:Drosophila_2:1625721_s_at:122:121; Interrogation_Position=82; Antisense; AGCGGCTATCTGAACATTTTCATCA
>probe:Drosophila_2:1625721_s_at:480:613; Interrogation_Position=92; Antisense; TGAACATTTTCATCAGCCACCACGA
>probe:Drosophila_2:1625721_s_at:122:191; Interrogation_Position=94; Antisense; AACATTTTCATCAGCCACCACGAGG
>probe:Drosophila_2:1625721_s_at:553:15; Interrogation_Position=97; Antisense; ATTTTCATCAGCCACCACGAGGTGA
>probe:Drosophila_2:1625721_s_at:186:697; Interrogation_Position=99; Antisense; TTTCATCAGCCACCACGAGGTGATG

Paste this into a BLAST search page for me
ATCAGCCACCACGAGGTGATGAAACCCACCACGAGGTGATGAAACTGATGATGGAACTCCTTCCTCTGAAGTCGCTGGAACTCCTTCCTCTGAAGTCGCCGATCCTGCTCCTATGCCTAACCATTTATGCCTAACCATTTCCACTTCGGTTAACCATTTCCACTTCGGTCAGCGGATTTCCACTTCGGTCAGCGGCTATCTCCACTTCGGTCAGCGGCTATCTGAAGCGGCTATCTGAACATTTTCATCATGAACATTTTCATCAGCCACCACGAAACATTTTCATCAGCCACCACGAGGATTTTCATCAGCCACCACGAGGTGATTTCATCAGCCACCACGAGGTGATG

Full Affymetrix probeset data:

Annotations for 1625721_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime