FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625722_at:

>probe:Drosophila_2:1625722_at:296:451; Interrogation_Position=1447; Antisense; GATCGTCAGCTATTGGGAGGCCTTT
>probe:Drosophila_2:1625722_at:445:31; Interrogation_Position=1539; Antisense; ATAACCAACAGCTATGCGCGCTATT
>probe:Drosophila_2:1625722_at:406:321; Interrogation_Position=1554; Antisense; GCGCGCTATTAACTAATTCTGCGGG
>probe:Drosophila_2:1625722_at:686:9; Interrogation_Position=1569; Antisense; ATTCTGCGGGACCAAATTCGATCTT
>probe:Drosophila_2:1625722_at:362:655; Interrogation_Position=1593; Antisense; TAATCTTGCGATTTGGAGCTACAAC
>probe:Drosophila_2:1625722_at:335:665; Interrogation_Position=1612; Antisense; TACAACTTCGCCTTAAGCACTTATC
>probe:Drosophila_2:1625722_at:177:113; Interrogation_Position=1627; Antisense; AGCACTTATCTTGCAATTTGCCGCC
>probe:Drosophila_2:1625722_at:667:17; Interrogation_Position=1642; Antisense; ATTTGCCGCCGAAGCTCGTATTTTT
>probe:Drosophila_2:1625722_at:382:601; Interrogation_Position=1665; Antisense; TTTGGGAAACTGCTTCCGATTCCTC
>probe:Drosophila_2:1625722_at:8:465; Interrogation_Position=1682; Antisense; GATTCCTCTCAAGCATTTCGCGATG
>probe:Drosophila_2:1625722_at:461:635; Interrogation_Position=1699; Antisense; TCGCGATGCATTCACAATGCCTCTA
>probe:Drosophila_2:1625722_at:212:235; Interrogation_Position=1714; Antisense; AATGCCTCTATCTCTTTATTCGTAC
>probe:Drosophila_2:1625722_at:488:393; Interrogation_Position=1762; Antisense; GAAAGTTTGCTACAGACCCAGGGAT
>probe:Drosophila_2:1625722_at:664:267; Interrogation_Position=1780; Antisense; CAGGGATCTGCGTATTCTCATTCAA

Paste this into a BLAST search page for me
GATCGTCAGCTATTGGGAGGCCTTTATAACCAACAGCTATGCGCGCTATTGCGCGCTATTAACTAATTCTGCGGGATTCTGCGGGACCAAATTCGATCTTTAATCTTGCGATTTGGAGCTACAACTACAACTTCGCCTTAAGCACTTATCAGCACTTATCTTGCAATTTGCCGCCATTTGCCGCCGAAGCTCGTATTTTTTTTGGGAAACTGCTTCCGATTCCTCGATTCCTCTCAAGCATTTCGCGATGTCGCGATGCATTCACAATGCCTCTAAATGCCTCTATCTCTTTATTCGTACGAAAGTTTGCTACAGACCCAGGGATCAGGGATCTGCGTATTCTCATTCAA

Full Affymetrix probeset data:

Annotations for 1625722_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720