FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625723_at:

>probe:Drosophila_2:1625723_at:629:247; Interrogation_Position=1042; Antisense; AATTGCGAGCACACATCCGTCGTCA
>probe:Drosophila_2:1625723_at:309:291; Interrogation_Position=1069; Antisense; CGGGCGACCGTCCATACAAGTGTAT
>probe:Drosophila_2:1625723_at:274:161; Interrogation_Position=1084; Antisense; ACAAGTGTATGTACTGCGACCGCCA
>probe:Drosophila_2:1625723_at:527:527; Interrogation_Position=1185; Antisense; GGGAAAACTTTTACGCACACAGCCA
>probe:Drosophila_2:1625723_at:17:47; Interrogation_Position=1209; Antisense; ATCCTCAAAAATCACATCCTTTCGC
>probe:Drosophila_2:1625723_at:259:635; Interrogation_Position=1230; Antisense; TCGCACTCCGCCCAAAAGAATTACA
>probe:Drosophila_2:1625723_at:505:539; Interrogation_Position=1260; Antisense; GGTATCTGTTGCAAGTCATTCACTC
>probe:Drosophila_2:1625723_at:281:9; Interrogation_Position=1347; Antisense; ATTCCCAGCTCTCCGGAAATGTTAG
>probe:Drosophila_2:1625723_at:31:205; Interrogation_Position=1428; Antisense; AAGCCACTTTTCCAGAATAGACCAG
>probe:Drosophila_2:1625723_at:447:217; Interrogation_Position=912; Antisense; AAGTTCATGTGCATCCTGTGCGGAA
>probe:Drosophila_2:1625723_at:581:45; Interrogation_Position=924; Antisense; ATCCTGTGCGGAAACGTCTTTTACA
>probe:Drosophila_2:1625723_at:672:211; Interrogation_Position=948; Antisense; AAGAAATCTGTTTTCACGGCCCACA
>probe:Drosophila_2:1625723_at:614:321; Interrogation_Position=966; Antisense; GCCCACATGATGACCCATTCAGAGT
>probe:Drosophila_2:1625723_at:630:665; Interrogation_Position=990; Antisense; TACAAGCCCCACCAATGCGAAATAT

Paste this into a BLAST search page for me
AATTGCGAGCACACATCCGTCGTCACGGGCGACCGTCCATACAAGTGTATACAAGTGTATGTACTGCGACCGCCAGGGAAAACTTTTACGCACACAGCCAATCCTCAAAAATCACATCCTTTCGCTCGCACTCCGCCCAAAAGAATTACAGGTATCTGTTGCAAGTCATTCACTCATTCCCAGCTCTCCGGAAATGTTAGAAGCCACTTTTCCAGAATAGACCAGAAGTTCATGTGCATCCTGTGCGGAAATCCTGTGCGGAAACGTCTTTTACAAAGAAATCTGTTTTCACGGCCCACAGCCCACATGATGACCCATTCAGAGTTACAAGCCCCACCAATGCGAAATAT

Full Affymetrix probeset data:

Annotations for 1625723_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720