FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625725_at:

>probe:Drosophila_2:1625725_at:263:93; Interrogation_Position=483; Antisense; AGTTAATCCGAGAGCTCTCCGACGA
>probe:Drosophila_2:1625725_at:117:167; Interrogation_Position=589; Antisense; AAATGTACCCATTTACCACAATCGC
>probe:Drosophila_2:1625725_at:723:235; Interrogation_Position=608; Antisense; AATCGCGACGAGTGGATCACCTGGA
>probe:Drosophila_2:1625725_at:432:327; Interrogation_Position=637; Antisense; GCGAGGAGATCCTGTACTCCACATA
>probe:Drosophila_2:1625725_at:419:17; Interrogation_Position=681; Antisense; ATTTGTTGGTAATAGCCCCACTCAG
>probe:Drosophila_2:1625725_at:619:123; Interrogation_Position=704; Antisense; AGCGCAAACTCTCTGTCCAAAATGG
>probe:Drosophila_2:1625725_at:678:227; Interrogation_Position=724; Antisense; AATGGCCACCGGGATTTGCGATAAT
>probe:Drosophila_2:1625725_at:687:593; Interrogation_Position=773; Antisense; TGGGACCTTGAGAAGCCGCTGCTCT
>probe:Drosophila_2:1625725_at:546:691; Interrogation_Position=797; Antisense; TTTGCACCTGCGATGAATACCCGTA
>probe:Drosophila_2:1625725_at:148:241; Interrogation_Position=812; Antisense; AATACCCGTATGTACGACCATCCAA
>probe:Drosophila_2:1625725_at:420:551; Interrogation_Position=880; Antisense; GGAGATACCCTGCATATCCAAGACT
>probe:Drosophila_2:1625725_at:124:253; Interrogation_Position=898; Antisense; CAAGACTCTGATGTGCGGTGATACT
>probe:Drosophila_2:1625725_at:590:301; Interrogation_Position=933; Antisense; CCATGGCGGAGGTACCCACAATTGT
>probe:Drosophila_2:1625725_at:686:683; Interrogation_Position=969; Antisense; TATCCGCCTTTCAGCCGATTAAATA

Paste this into a BLAST search page for me
AGTTAATCCGAGAGCTCTCCGACGAAAATGTACCCATTTACCACAATCGCAATCGCGACGAGTGGATCACCTGGAGCGAGGAGATCCTGTACTCCACATAATTTGTTGGTAATAGCCCCACTCAGAGCGCAAACTCTCTGTCCAAAATGGAATGGCCACCGGGATTTGCGATAATTGGGACCTTGAGAAGCCGCTGCTCTTTTGCACCTGCGATGAATACCCGTAAATACCCGTATGTACGACCATCCAAGGAGATACCCTGCATATCCAAGACTCAAGACTCTGATGTGCGGTGATACTCCATGGCGGAGGTACCCACAATTGTTATCCGCCTTTCAGCCGATTAAATA

Full Affymetrix probeset data:

Annotations for 1625725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720