FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625727_at:

>probe:Drosophila_2:1625727_at:372:245; Interrogation_Position=1109; Antisense; AATTCGCACAAGACGGATACTACCA
>probe:Drosophila_2:1625727_at:92:255; Interrogation_Position=1132; Antisense; CAACACTCCCATTTCTGCAGAAAAG
>probe:Drosophila_2:1625727_at:362:713; Interrogation_Position=1178; Antisense; TTCTATTCCGAAATGACACCCGTGC
>probe:Drosophila_2:1625727_at:434:133; Interrogation_Position=1195; Antisense; ACCCGTGCTGGCTTCAAATTCAAAT
>probe:Drosophila_2:1625727_at:600:33; Interrogation_Position=1240; Antisense; ATCAACTGATGTATCCTGGCCTAGC
>probe:Drosophila_2:1625727_at:180:581; Interrogation_Position=1256; Antisense; TGGCCTAGCCATCCATGCAACATAA
>probe:Drosophila_2:1625727_at:48:463; Interrogation_Position=1292; Antisense; GATTACACTAACTTTCAACCAATAG
>probe:Drosophila_2:1625727_at:77:457; Interrogation_Position=1319; Antisense; GATAGCATTGCTGAGCAGTTCCAAT
>probe:Drosophila_2:1625727_at:641:49; Interrogation_Position=1342; Antisense; ATGCCTGCATGATAGCGCTGGGTAT
>probe:Drosophila_2:1625727_at:645:315; Interrogation_Position=1356; Antisense; GCGCTGGGTATGATCGAAACGACGA
>probe:Drosophila_2:1625727_at:699:129; Interrogation_Position=1392; Antisense; ACCTTCTTGATGTTTGTGTTACGCC
>probe:Drosophila_2:1625727_at:188:443; Interrogation_Position=1400; Antisense; GATGTTTGTGTTACGCCTTATTGAA
>probe:Drosophila_2:1625727_at:214:221; Interrogation_Position=1491; Antisense; AAGTGGCTTGTATTATCGACGATTT
>probe:Drosophila_2:1625727_at:388:409; Interrogation_Position=1508; Antisense; GACGATTTGATTTCTCTAGCGCCAT

Paste this into a BLAST search page for me
AATTCGCACAAGACGGATACTACCACAACACTCCCATTTCTGCAGAAAAGTTCTATTCCGAAATGACACCCGTGCACCCGTGCTGGCTTCAAATTCAAATATCAACTGATGTATCCTGGCCTAGCTGGCCTAGCCATCCATGCAACATAAGATTACACTAACTTTCAACCAATAGGATAGCATTGCTGAGCAGTTCCAATATGCCTGCATGATAGCGCTGGGTATGCGCTGGGTATGATCGAAACGACGAACCTTCTTGATGTTTGTGTTACGCCGATGTTTGTGTTACGCCTTATTGAAAAGTGGCTTGTATTATCGACGATTTGACGATTTGATTTCTCTAGCGCCAT

Full Affymetrix probeset data:

Annotations for 1625727_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720