Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625728_at:

>probe:Drosophila_2:1625728_at:296:109; Interrogation_Position=1637; Antisense; AGAAGTTGTCCACGGTACGCAGCTG
>probe:Drosophila_2:1625728_at:448:721; Interrogation_Position=1686; Antisense; TTGAATTGAATTCGGCGCCTGGTGC
>probe:Drosophila_2:1625728_at:416:533; Interrogation_Position=1706; Antisense; GGTGCGCATTTGTTAGAGTATTTTT
>probe:Drosophila_2:1625728_at:414:75; Interrogation_Position=1746; Antisense; AGGAGCATCGCTTAGTACAATAGAC
>probe:Drosophila_2:1625728_at:464:61; Interrogation_Position=1806; Antisense; ATGTCTCTACTAGATTCGCTTTCTA
>probe:Drosophila_2:1625728_at:430:463; Interrogation_Position=1818; Antisense; GATTCGCTTTCTATGTACAGCAGTA
>probe:Drosophila_2:1625728_at:239:489; Interrogation_Position=1832; Antisense; GTACAGCAGTATCATTACCGCTATT
>probe:Drosophila_2:1625728_at:581:297; Interrogation_Position=1850; Antisense; CGCTATTTGTAACGCTCCCCAAGAA
>probe:Drosophila_2:1625728_at:214:633; Interrogation_Position=1865; Antisense; TCCCCAAGAACCCTATGTCTATATA
>probe:Drosophila_2:1625728_at:316:21; Interrogation_Position=1889; Antisense; ATATTGCTATTCCTATTCGTAATTG
>probe:Drosophila_2:1625728_at:400:61; Interrogation_Position=1916; Antisense; ATGTAAGTCCTAACACCGATGGCCT
>probe:Drosophila_2:1625728_at:76:133; Interrogation_Position=1930; Antisense; ACCGATGGCCTTTTACTTGTATACT
>probe:Drosophila_2:1625728_at:489:309; Interrogation_Position=1958; Antisense; CCACCCACTTGTTTGCAGCTAAAAT
>probe:Drosophila_2:1625728_at:532:461; Interrogation_Position=2007; Antisense; GATTTTCTATTTTAAGCGCACTTCA

Paste this into a BLAST search page for me
AGAAGTTGTCCACGGTACGCAGCTGTTGAATTGAATTCGGCGCCTGGTGCGGTGCGCATTTGTTAGAGTATTTTTAGGAGCATCGCTTAGTACAATAGACATGTCTCTACTAGATTCGCTTTCTAGATTCGCTTTCTATGTACAGCAGTAGTACAGCAGTATCATTACCGCTATTCGCTATTTGTAACGCTCCCCAAGAATCCCCAAGAACCCTATGTCTATATAATATTGCTATTCCTATTCGTAATTGATGTAAGTCCTAACACCGATGGCCTACCGATGGCCTTTTACTTGTATACTCCACCCACTTGTTTGCAGCTAAAATGATTTTCTATTTTAAGCGCACTTCA

Full Affymetrix probeset data:

Annotations for 1625728_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime