Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625731_at:

>probe:Drosophila_2:1625731_at:56:17; Interrogation_Position=1014; Antisense; ATATCCAAGTCCCACGGAATCCTAT
>probe:Drosophila_2:1625731_at:466:431; Interrogation_Position=1072; Antisense; GAGTCATATCCCAGCCAAACTGAGT
>probe:Drosophila_2:1625731_at:546:607; Interrogation_Position=1092; Antisense; TGAGTCCTATCAACCGCGTACGGAA
>probe:Drosophila_2:1625731_at:23:455; Interrogation_Position=1140; Antisense; GATCAAGCCATATGGTGGTCCCGAT
>probe:Drosophila_2:1625731_at:326:221; Interrogation_Position=734; Antisense; AAGTGGTTCCACTCGTGAGCAAAGT
>probe:Drosophila_2:1625731_at:217:311; Interrogation_Position=770; Antisense; CCAAAATCTCCTCCAGCATTAAGTA
>probe:Drosophila_2:1625731_at:424:115; Interrogation_Position=784; Antisense; AGCATTAAGTATGCCGCCTCAGCGG
>probe:Drosophila_2:1625731_at:551:315; Interrogation_Position=799; Antisense; GCCTCAGCGGTTTCATCATCATCAT
>probe:Drosophila_2:1625731_at:126:521; Interrogation_Position=835; Antisense; GTGGCCAAGATAAAGACTCCCTACG
>probe:Drosophila_2:1625731_at:708:257; Interrogation_Position=879; Antisense; CACACCGTCTCCCATTTATGAGAGA
>probe:Drosophila_2:1625731_at:545:425; Interrogation_Position=898; Antisense; GAGAGATCCACATCGTATCCTATTG
>probe:Drosophila_2:1625731_at:715:375; Interrogation_Position=925; Antisense; GAAGCACCCAAGGAATACTCGGCGC
>probe:Drosophila_2:1625731_at:165:219; Interrogation_Position=959; Antisense; AAGTCTATCCCGTTGTGCAGAGCCA
>probe:Drosophila_2:1625731_at:431:413; Interrogation_Position=978; Antisense; GAGCCAAACGGAGTCGTATCCCAGC

Paste this into a BLAST search page for me
ATATCCAAGTCCCACGGAATCCTATGAGTCATATCCCAGCCAAACTGAGTTGAGTCCTATCAACCGCGTACGGAAGATCAAGCCATATGGTGGTCCCGATAAGTGGTTCCACTCGTGAGCAAAGTCCAAAATCTCCTCCAGCATTAAGTAAGCATTAAGTATGCCGCCTCAGCGGGCCTCAGCGGTTTCATCATCATCATGTGGCCAAGATAAAGACTCCCTACGCACACCGTCTCCCATTTATGAGAGAGAGAGATCCACATCGTATCCTATTGGAAGCACCCAAGGAATACTCGGCGCAAGTCTATCCCGTTGTGCAGAGCCAGAGCCAAACGGAGTCGTATCCCAGC

Full Affymetrix probeset data:

Annotations for 1625731_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime