FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625732_at:

>probe:Drosophila_2:1625732_at:7:279; Interrogation_Position=4396; Antisense; CTATGTGATGTTTTTTATTTCTTCT
>probe:Drosophila_2:1625732_at:69:601; Interrogation_Position=4469; Antisense; TGTTTTGTTTTTGCGATGGAGTTAA
>probe:Drosophila_2:1625732_at:556:697; Interrogation_Position=4565; Antisense; TTTAAGCATAAACAATGGCGTCAAG
>probe:Drosophila_2:1625732_at:12:581; Interrogation_Position=4580; Antisense; TGGCGTCAAGAGCAAACAATTTTAA
>probe:Drosophila_2:1625732_at:127:63; Interrogation_Position=4644; Antisense; ATGTGTGTTGTTCCATTTGAAACGG
>probe:Drosophila_2:1625732_at:608:283; Interrogation_Position=4660; Antisense; TTGAAACGGGACACTTTGAAATATT
>probe:Drosophila_2:1625732_at:165:423; Interrogation_Position=4721; Antisense; GAGAATGGCATCCTACCATCATGTG
>probe:Drosophila_2:1625732_at:157:569; Interrogation_Position=4727; Antisense; GGCATCCTACCATCATGTGGAACAA
>probe:Drosophila_2:1625732_at:367:475; Interrogation_Position=4754; Antisense; GTTACGGATTAAATTGCATAGGTCT
>probe:Drosophila_2:1625732_at:183:487; Interrogation_Position=4793; Antisense; GTAGCTAATTACCAGGCCACACTCA
>probe:Drosophila_2:1625732_at:718:257; Interrogation_Position=4853; Antisense; CACACCATCACATTTACACAGACAT
>probe:Drosophila_2:1625732_at:257:709; Interrogation_Position=4866; Antisense; TTACACAGACATAGACAAACCAAGT
>probe:Drosophila_2:1625732_at:157:83; Interrogation_Position=4888; Antisense; AGTAAAAACCATGCAATTTGAGCCG
>probe:Drosophila_2:1625732_at:135:17; Interrogation_Position=4903; Antisense; ATTTGAGCCGAAAGACGAGAGATTC

Paste this into a BLAST search page for me
CTATGTGATGTTTTTTATTTCTTCTTGTTTTGTTTTTGCGATGGAGTTAATTTAAGCATAAACAATGGCGTCAAGTGGCGTCAAGAGCAAACAATTTTAAATGTGTGTTGTTCCATTTGAAACGGTTGAAACGGGACACTTTGAAATATTGAGAATGGCATCCTACCATCATGTGGGCATCCTACCATCATGTGGAACAAGTTACGGATTAAATTGCATAGGTCTGTAGCTAATTACCAGGCCACACTCACACACCATCACATTTACACAGACATTTACACAGACATAGACAAACCAAGTAGTAAAAACCATGCAATTTGAGCCGATTTGAGCCGAAAGACGAGAGATTC

Full Affymetrix probeset data:

Annotations for 1625732_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720