FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625733_at:

>probe:Drosophila_2:1625733_at:118:405; Interrogation_Position=139; Antisense; GACTAATTATCATCGTGTGCAGGAA
>probe:Drosophila_2:1625733_at:532:207; Interrogation_Position=178; Antisense; AAGCTATGCAGATGGCGTTGCCGAT
>probe:Drosophila_2:1625733_at:108:223; Interrogation_Position=212; Antisense; AAGGTCTTCCAAGAGAGCTTCGATG
>probe:Drosophila_2:1625733_at:400:1; Interrogation_Position=249; Antisense; ATGGCTTTAAAACTGGATTCGAACT
>probe:Drosophila_2:1625733_at:448:311; Interrogation_Position=275; Antisense; GCCAAACTGAGTGCCTTCTATGAAA
>probe:Drosophila_2:1625733_at:401:203; Interrogation_Position=298; Antisense; AACCATAAGCAATGCGGCGGGAGCT
>probe:Drosophila_2:1625733_at:521:341; Interrogation_Position=353; Antisense; GCTTATCAAAAACTCCAACTGGCAG
>probe:Drosophila_2:1625733_at:439:173; Interrogation_Position=389; Antisense; AAAGCACACTTCACATATTTGGAGC
>probe:Drosophila_2:1625733_at:304:337; Interrogation_Position=422; Antisense; GCTCCACTCAACGTTATATCCGAAA
>probe:Drosophila_2:1625733_at:681:209; Interrogation_Position=452; Antisense; AAGACCTACGTGGACGACCTCCTAG
>probe:Drosophila_2:1625733_at:122:413; Interrogation_Position=467; Antisense; GACCTCCTAGGAAAACTGGCACAGC
>probe:Drosophila_2:1625733_at:599:253; Interrogation_Position=491; Antisense; CAACTCCCGGCAACTACGAATTTAT
>probe:Drosophila_2:1625733_at:338:281; Interrogation_Position=53; Antisense; CTCTGCATGCTTTAATATTCTTCCT
>probe:Drosophila_2:1625733_at:259:393; Interrogation_Position=586; Antisense; GAAAGTATATCTTCGCGCGACTTAT

Paste this into a BLAST search page for me
GACTAATTATCATCGTGTGCAGGAAAAGCTATGCAGATGGCGTTGCCGATAAGGTCTTCCAAGAGAGCTTCGATGATGGCTTTAAAACTGGATTCGAACTGCCAAACTGAGTGCCTTCTATGAAAAACCATAAGCAATGCGGCGGGAGCTGCTTATCAAAAACTCCAACTGGCAGAAAGCACACTTCACATATTTGGAGCGCTCCACTCAACGTTATATCCGAAAAAGACCTACGTGGACGACCTCCTAGGACCTCCTAGGAAAACTGGCACAGCCAACTCCCGGCAACTACGAATTTATCTCTGCATGCTTTAATATTCTTCCTGAAAGTATATCTTCGCGCGACTTAT

Full Affymetrix probeset data:

Annotations for 1625733_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720