FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625734_at:

>probe:Drosophila_2:1625734_at:452:447; Interrogation_Position=2912; Antisense; GATGCGCGATGCTTTCAACAAGCGC
>probe:Drosophila_2:1625734_at:496:619; Interrogation_Position=2921; Antisense; TGCTTTCAACAAGCGCCTCAAAAGT
>probe:Drosophila_2:1625734_at:84:331; Interrogation_Position=2947; Antisense; GCGTGGCCAGCGGAAATATATCGCA
>probe:Drosophila_2:1625734_at:629:683; Interrogation_Position=2965; Antisense; TATCGCAGCGTGGTAATCATCTAGA
>probe:Drosophila_2:1625734_at:171:637; Interrogation_Position=2995; Antisense; TCGAATAAGGATTTCCCCACAGCCA
>probe:Drosophila_2:1625734_at:538:265; Interrogation_Position=3053; Antisense; CATGGCACCCACCAGTTTTAGTTTT
>probe:Drosophila_2:1625734_at:486:703; Interrogation_Position=3081; Antisense; TTATTATGCTTTTGCCACTGCCAAG
>probe:Drosophila_2:1625734_at:358:627; Interrogation_Position=3093; Antisense; TGCCACTGCCAAGCTTTGTTATTTT
>probe:Drosophila_2:1625734_at:609:311; Interrogation_Position=3100; Antisense; GCCAAGCTTTGTTATTTTTCTATAT
>probe:Drosophila_2:1625734_at:165:35; Interrogation_Position=3135; Antisense; ATCACAATTGTTTAAGTCCAGTCCA
>probe:Drosophila_2:1625734_at:729:475; Interrogation_Position=3144; Antisense; GTTTAAGTCCAGTCCATACGTAATG
>probe:Drosophila_2:1625734_at:545:707; Interrogation_Position=3169; Antisense; TTAAAATTTAATGTAGCCGGCCAAT
>probe:Drosophila_2:1625734_at:187:5; Interrogation_Position=3264; Antisense; ATTGAGAACGGGTCGACGATCGATT
>probe:Drosophila_2:1625734_at:500:133; Interrogation_Position=3271; Antisense; ACGGGTCGACGATCGATTTAAATCT

Paste this into a BLAST search page for me
GATGCGCGATGCTTTCAACAAGCGCTGCTTTCAACAAGCGCCTCAAAAGTGCGTGGCCAGCGGAAATATATCGCATATCGCAGCGTGGTAATCATCTAGATCGAATAAGGATTTCCCCACAGCCACATGGCACCCACCAGTTTTAGTTTTTTATTATGCTTTTGCCACTGCCAAGTGCCACTGCCAAGCTTTGTTATTTTGCCAAGCTTTGTTATTTTTCTATATATCACAATTGTTTAAGTCCAGTCCAGTTTAAGTCCAGTCCATACGTAATGTTAAAATTTAATGTAGCCGGCCAATATTGAGAACGGGTCGACGATCGATTACGGGTCGACGATCGATTTAAATCT

Full Affymetrix probeset data:

Annotations for 1625734_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720