FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625736_at:

>probe:Drosophila_2:1625736_at:193:145; Interrogation_Position=470; Antisense; ACATCAAAAAATGGGCGTGTTCCGT
>probe:Drosophila_2:1625736_at:36:325; Interrogation_Position=484; Antisense; GCGTGTTCCGTTGAGGATGAAGTAA
>probe:Drosophila_2:1625736_at:542:199; Interrogation_Position=518; Antisense; AACGCATTGTTAGTAGAGACGCTCA
>probe:Drosophila_2:1625736_at:62:425; Interrogation_Position=533; Antisense; GAGACGCTCAGTTGCAAGACCAGCT
>probe:Drosophila_2:1625736_at:83:469; Interrogation_Position=543; Antisense; GTTGCAAGACCAGCTATCACAGGAA
>probe:Drosophila_2:1625736_at:628:457; Interrogation_Position=580; Antisense; GATATACTCTTTTATCGGCTAGATA
>probe:Drosophila_2:1625736_at:447:175; Interrogation_Position=624; Antisense; AAACGAGTTACTGTCAATTTGTGAA
>probe:Drosophila_2:1625736_at:719:231; Interrogation_Position=730; Antisense; AATGAACATAAACGCCTCACACAGG
>probe:Drosophila_2:1625736_at:685:651; Interrogation_Position=746; Antisense; TCACACAGGCATGGAACGAGGTTAT
>probe:Drosophila_2:1625736_at:552:135; Interrogation_Position=761; Antisense; ACGAGGTTATTATAGCCATTCAGCT
>probe:Drosophila_2:1625736_at:254:703; Interrogation_Position=799; Antisense; TTATTTCAAGTACAAGACGCAGCAA
>probe:Drosophila_2:1625736_at:217:105; Interrogation_Position=813; Antisense; AGACGCAGCAAGAAAACACAGGGAG
>probe:Drosophila_2:1625736_at:535:157; Interrogation_Position=828; Antisense; ACACAGGGAGGCAATGAAACACAAT
>probe:Drosophila_2:1625736_at:408:405; Interrogation_Position=932; Antisense; GACTGGCAGATGAAACTAGTTCCTT

Paste this into a BLAST search page for me
ACATCAAAAAATGGGCGTGTTCCGTGCGTGTTCCGTTGAGGATGAAGTAAAACGCATTGTTAGTAGAGACGCTCAGAGACGCTCAGTTGCAAGACCAGCTGTTGCAAGACCAGCTATCACAGGAAGATATACTCTTTTATCGGCTAGATAAAACGAGTTACTGTCAATTTGTGAAAATGAACATAAACGCCTCACACAGGTCACACAGGCATGGAACGAGGTTATACGAGGTTATTATAGCCATTCAGCTTTATTTCAAGTACAAGACGCAGCAAAGACGCAGCAAGAAAACACAGGGAGACACAGGGAGGCAATGAAACACAATGACTGGCAGATGAAACTAGTTCCTT

Full Affymetrix probeset data:

Annotations for 1625736_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720