Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625737_at:

>probe:Drosophila_2:1625737_at:612:589; Interrogation_Position=509; Antisense; TGAGGGTTCCGCACGAGCAGTACTA
>probe:Drosophila_2:1625737_at:144:403; Interrogation_Position=559; Antisense; GACATTGCTCTGTTGCGTCTGAAGA
>probe:Drosophila_2:1625737_at:325:241; Interrogation_Position=593; Antisense; AATACACTCTTCAGATCAGACCCAT
>probe:Drosophila_2:1625737_at:227:103; Interrogation_Position=610; Antisense; AGACCCATTTGCATTTGGCCTGGCA
>probe:Drosophila_2:1625737_at:123:615; Interrogation_Position=636; Antisense; TGAATTGTCAACTTCCTCCTTCAAA
>probe:Drosophila_2:1625737_at:625:141; Interrogation_Position=662; Antisense; ACTTCCCTTTTCAAATTGCCGGCTG
>probe:Drosophila_2:1625737_at:21:525; Interrogation_Position=687; Antisense; GGGCGATTCGGGTCTGCAGCAAAAA
>probe:Drosophila_2:1625737_at:560:241; Interrogation_Position=706; Antisense; CAAAAAAGCACCGTACTTCGCCAAG
>probe:Drosophila_2:1625737_at:156:719; Interrogation_Position=722; Antisense; TTCGCCAAGGCACCATCAGTGGAAT
>probe:Drosophila_2:1625737_at:119:615; Interrogation_Position=764; Antisense; TGAATCGGTATCCAACACTGCTCGT
>probe:Drosophila_2:1625737_at:594:593; Interrogation_Position=842; Antisense; TGGGAGATTCCGGTAGCCCGCTGAT
>probe:Drosophila_2:1625737_at:672:453; Interrogation_Position=889; Antisense; GATCAATTTTATTACCTAGCCGGAA
>probe:Drosophila_2:1625737_at:527:555; Interrogation_Position=931; Antisense; GGACCCTCCAGTTACGGATATGGGC
>probe:Drosophila_2:1625737_at:262:681; Interrogation_Position=949; Antisense; TATGGGCCAGCGGTTTACACGAAAA

Paste this into a BLAST search page for me
TGAGGGTTCCGCACGAGCAGTACTAGACATTGCTCTGTTGCGTCTGAAGAAATACACTCTTCAGATCAGACCCATAGACCCATTTGCATTTGGCCTGGCATGAATTGTCAACTTCCTCCTTCAAAACTTCCCTTTTCAAATTGCCGGCTGGGGCGATTCGGGTCTGCAGCAAAAACAAAAAAGCACCGTACTTCGCCAAGTTCGCCAAGGCACCATCAGTGGAATTGAATCGGTATCCAACACTGCTCGTTGGGAGATTCCGGTAGCCCGCTGATGATCAATTTTATTACCTAGCCGGAAGGACCCTCCAGTTACGGATATGGGCTATGGGCCAGCGGTTTACACGAAAA

Full Affymetrix probeset data:

Annotations for 1625737_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime