Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625738_at:

>probe:Drosophila_2:1625738_at:27:629; Interrogation_Position=1381; Antisense; TGCCACCGAGATCAGCGACAAGCTA
>probe:Drosophila_2:1625738_at:18:657; Interrogation_Position=1404; Antisense; TAACGGATACGCTTAACCTGGAGGT
>probe:Drosophila_2:1625738_at:155:381; Interrogation_Position=1433; Antisense; GAACCGGTGCTGAAAGTCCATCGCG
>probe:Drosophila_2:1625738_at:387:233; Interrogation_Position=1485; Antisense; AATGCGATCGCTACGTGCTCTGTCA
>probe:Drosophila_2:1625738_at:446:139; Interrogation_Position=1497; Antisense; ACGTGCTCTGTCAGCTGAATGCAGC
>probe:Drosophila_2:1625738_at:370:369; Interrogation_Position=1513; Antisense; GAATGCAGCGGCTCTCGATCAGCAG
>probe:Drosophila_2:1625738_at:353:439; Interrogation_Position=1546; Antisense; GAGGCAGCACGACCAATACCAGCAG
>probe:Drosophila_2:1625738_at:376:209; Interrogation_Position=1583; Antisense; AAGCAGAGCCAACTGAATCGCCCGA
>probe:Drosophila_2:1625738_at:560:325; Interrogation_Position=1613; Antisense; GCGTCCAGTCTAATTGCCGGAGTTA
>probe:Drosophila_2:1625738_at:405:65; Interrogation_Position=1664; Antisense; ATGGGTGCGGCAATCTTCATTAGCA
>probe:Drosophila_2:1625738_at:525:645; Interrogation_Position=1716; Antisense; TCTTCGGTGTGATCAATGCGCCATA
>probe:Drosophila_2:1625738_at:610:439; Interrogation_Position=1748; Antisense; GAGGCCAAATATCCAGTCGACTGCA
>probe:Drosophila_2:1625738_at:452:229; Interrogation_Position=1772; Antisense; AATGGTTTCCACGAGGGCGAGGCCA
>probe:Drosophila_2:1625738_at:347:327; Interrogation_Position=1788; Antisense; GCGAGGCCAAGGTGACCACGGAATA

Paste this into a BLAST search page for me
TGCCACCGAGATCAGCGACAAGCTATAACGGATACGCTTAACCTGGAGGTGAACCGGTGCTGAAAGTCCATCGCGAATGCGATCGCTACGTGCTCTGTCAACGTGCTCTGTCAGCTGAATGCAGCGAATGCAGCGGCTCTCGATCAGCAGGAGGCAGCACGACCAATACCAGCAGAAGCAGAGCCAACTGAATCGCCCGAGCGTCCAGTCTAATTGCCGGAGTTAATGGGTGCGGCAATCTTCATTAGCATCTTCGGTGTGATCAATGCGCCATAGAGGCCAAATATCCAGTCGACTGCAAATGGTTTCCACGAGGGCGAGGCCAGCGAGGCCAAGGTGACCACGGAATA

Full Affymetrix probeset data:

Annotations for 1625738_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime