Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625739_at:

>probe:Drosophila_2:1625739_at:368:65; Interrogation_Position=1135; Antisense; ATGGTGGCTACTTTCTGTTCGTCGA
>probe:Drosophila_2:1625739_at:278:557; Interrogation_Position=1164; Antisense; GGACTCATCGATTATGGCAACCACT
>probe:Drosophila_2:1625739_at:39:105; Interrogation_Position=1216; Antisense; AGACGCTTCAGTTCGAGCAGGCTGT
>probe:Drosophila_2:1625739_at:307:269; Interrogation_Position=1233; Antisense; CAGGCTGTTCAGGAGGCTCTGGATA
>probe:Drosophila_2:1625739_at:501:449; Interrogation_Position=1263; Antisense; GATCCCGAAGAGACCCTGATTGTAG
>probe:Drosophila_2:1625739_at:500:413; Interrogation_Position=1313; Antisense; GACCATCTCTGGTTATCCTGGCAGA
>probe:Drosophila_2:1625739_at:585:299; Interrogation_Position=1343; Antisense; CCCCATTTTGGGTCTCAATCAGGAT
>probe:Drosophila_2:1625739_at:605:473; Interrogation_Position=1386; Antisense; GTTAAGTACGCCACTCTCAACTATG
>probe:Drosophila_2:1625739_at:587:309; Interrogation_Position=1445; Antisense; CCAGCGCATCGATCTTACGGATCAA
>probe:Drosophila_2:1625739_at:290:259; Interrogation_Position=1511; Antisense; CACTATTGGCGTTCATGCTGGCGAT
>probe:Drosophila_2:1625739_at:316:441; Interrogation_Position=1536; Antisense; GATGTGGGAATCTTCGCTACTGGTC
>probe:Drosophila_2:1625739_at:711:669; Interrogation_Position=1553; Antisense; TACTGGTCCGCAAAGTCATCTCTTC
>probe:Drosophila_2:1625739_at:43:277; Interrogation_Position=1619; Antisense; CTATGCCTCCTGCATTGGCAATGGA
>probe:Drosophila_2:1625739_at:546:555; Interrogation_Position=1641; Antisense; GGACCCACTCTCTGTGACAATGAGG

Paste this into a BLAST search page for me
ATGGTGGCTACTTTCTGTTCGTCGAGGACTCATCGATTATGGCAACCACTAGACGCTTCAGTTCGAGCAGGCTGTCAGGCTGTTCAGGAGGCTCTGGATAGATCCCGAAGAGACCCTGATTGTAGGACCATCTCTGGTTATCCTGGCAGACCCCATTTTGGGTCTCAATCAGGATGTTAAGTACGCCACTCTCAACTATGCCAGCGCATCGATCTTACGGATCAACACTATTGGCGTTCATGCTGGCGATGATGTGGGAATCTTCGCTACTGGTCTACTGGTCCGCAAAGTCATCTCTTCCTATGCCTCCTGCATTGGCAATGGAGGACCCACTCTCTGTGACAATGAGG

Full Affymetrix probeset data:

Annotations for 1625739_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime