FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625740_at:

>probe:Drosophila_2:1625740_at:297:489; Interrogation_Position=9423; Antisense; GTACGATATTATTTGCATACCTAGT
>probe:Drosophila_2:1625740_at:726:681; Interrogation_Position=9476; Antisense; TATGATATTCCTTCCCAGTTGTGGT
>probe:Drosophila_2:1625740_at:190:95; Interrogation_Position=9492; Antisense; AGTTGTGGTGGCTAGCATTTGCTCA
>probe:Drosophila_2:1625740_at:95:15; Interrogation_Position=9517; Antisense; ATTAGTTCTTTAGCTCTCTACTGCG
>probe:Drosophila_2:1625740_at:463:659; Interrogation_Position=9548; Antisense; TACGCACCGGTGTACCTACTATTTT
>probe:Drosophila_2:1625740_at:67:455; Interrogation_Position=9595; Antisense; GATCAATCCAGTTTTTTACACACAC
>probe:Drosophila_2:1625740_at:405:665; Interrogation_Position=9611; Antisense; TACACACACTTGTTATGTTTACACA
>probe:Drosophila_2:1625740_at:611:477; Interrogation_Position=9627; Antisense; GTTTACACAAAAGCTCACTGACACA
>probe:Drosophila_2:1625740_at:466:279; Interrogation_Position=9640; Antisense; CTCACTGACACAAAAATGGCTGGGT
>probe:Drosophila_2:1625740_at:651:395; Interrogation_Position=9698; Antisense; GAAATATTTCCCAGCTGCACATCAC
>probe:Drosophila_2:1625740_at:570:365; Interrogation_Position=9742; Antisense; GAATCTTTCCTAATCTCTGTAACCA
>probe:Drosophila_2:1625740_at:585:677; Interrogation_Position=9799; Antisense; TAGTTTACAATTCCCTCCCTATAAT
>probe:Drosophila_2:1625740_at:528:1; Interrogation_Position=9808; Antisense; ATTCCCTCCCTATAATGTGGTACTA
>probe:Drosophila_2:1625740_at:475:651; Interrogation_Position=9894; Antisense; TAATCAATTCGTCCCGTTTTGCAAT

Paste this into a BLAST search page for me
GTACGATATTATTTGCATACCTAGTTATGATATTCCTTCCCAGTTGTGGTAGTTGTGGTGGCTAGCATTTGCTCAATTAGTTCTTTAGCTCTCTACTGCGTACGCACCGGTGTACCTACTATTTTGATCAATCCAGTTTTTTACACACACTACACACACTTGTTATGTTTACACAGTTTACACAAAAGCTCACTGACACACTCACTGACACAAAAATGGCTGGGTGAAATATTTCCCAGCTGCACATCACGAATCTTTCCTAATCTCTGTAACCATAGTTTACAATTCCCTCCCTATAATATTCCCTCCCTATAATGTGGTACTATAATCAATTCGTCCCGTTTTGCAAT

Full Affymetrix probeset data:

Annotations for 1625740_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720