FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625742_at:

>probe:Drosophila_2:1625742_at:279:165; Interrogation_Position=1010; Antisense; AAATCTTAGCCATACCATATCGCAC
>probe:Drosophila_2:1625742_at:443:23; Interrogation_Position=1026; Antisense; ATATCGCACGGTGAGCACTTCACAA
>probe:Drosophila_2:1625742_at:273:53; Interrogation_Position=1062; Antisense; ATGCATTCCTCATTATGTTTCCTAG
>probe:Drosophila_2:1625742_at:25:159; Interrogation_Position=1099; Antisense; ACACACACCAAAACAATTCTCTCAA
>probe:Drosophila_2:1625742_at:463:5; Interrogation_Position=1114; Antisense; ATTCTCTCAATGGAGTGCTCGTAGT
>probe:Drosophila_2:1625742_at:649:631; Interrogation_Position=593; Antisense; TCCCAGGAGGCCAATAGCAACATTA
>probe:Drosophila_2:1625742_at:125:273; Interrogation_Position=613; Antisense; CATTAACCAGGGTGCCTGTGGCGGT
>probe:Drosophila_2:1625742_at:200:669; Interrogation_Position=674; Antisense; TACGACAATCATCCGGTTAGCCAGC
>probe:Drosophila_2:1625742_at:473:707; Interrogation_Position=690; Antisense; TTAGCCAGCTGCGTGGTGATCCCAG
>probe:Drosophila_2:1625742_at:105:427; Interrogation_Position=782; Antisense; GAGATGTGCAGCAACCTGTCGGTGC
>probe:Drosophila_2:1625742_at:299:131; Interrogation_Position=795; Antisense; ACCTGTCGGTGCTGAAGATGCTGGC
>probe:Drosophila_2:1625742_at:106:327; Interrogation_Position=951; Antisense; GCGAGCATTCGCATACTATTGTATT
>probe:Drosophila_2:1625742_at:590:35; Interrogation_Position=977; Antisense; ATCATTGCTTAGAATAGCCCTCCCT
>probe:Drosophila_2:1625742_at:145:365; Interrogation_Position=988; Antisense; GAATAGCCCTCCCTTAATATACAAA

Paste this into a BLAST search page for me
AAATCTTAGCCATACCATATCGCACATATCGCACGGTGAGCACTTCACAAATGCATTCCTCATTATGTTTCCTAGACACACACCAAAACAATTCTCTCAAATTCTCTCAATGGAGTGCTCGTAGTTCCCAGGAGGCCAATAGCAACATTACATTAACCAGGGTGCCTGTGGCGGTTACGACAATCATCCGGTTAGCCAGCTTAGCCAGCTGCGTGGTGATCCCAGGAGATGTGCAGCAACCTGTCGGTGCACCTGTCGGTGCTGAAGATGCTGGCGCGAGCATTCGCATACTATTGTATTATCATTGCTTAGAATAGCCCTCCCTGAATAGCCCTCCCTTAATATACAAA

Full Affymetrix probeset data:

Annotations for 1625742_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720