Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625743_at:

>probe:Drosophila_2:1625743_at:543:205; Interrogation_Position=1551; Antisense; AAGCGGAGGCGTTTCAGGGCACCAA
>probe:Drosophila_2:1625743_at:333:195; Interrogation_Position=1584; Antisense; AACTGCGTCCGGAAATGCTGTGTGA
>probe:Drosophila_2:1625743_at:171:383; Interrogation_Position=1657; Antisense; GAACTACCGATACTTCTACGCGATT
>probe:Drosophila_2:1625743_at:412:279; Interrogation_Position=1672; Antisense; CTACGCGATTAGCTCCGATGTGGAT
>probe:Drosophila_2:1625743_at:279:657; Interrogation_Position=1738; Antisense; TAAGAGCTGTCTAACCTGGTGCGAG
>probe:Drosophila_2:1625743_at:179:423; Interrogation_Position=1763; Antisense; GAGAATGTCTATCCCAGTGAGCCCA
>probe:Drosophila_2:1625743_at:580:85; Interrogation_Position=1778; Antisense; AGTGAGCCCATTTTTGTGCCTTCGC
>probe:Drosophila_2:1625743_at:606:437; Interrogation_Position=1817; Antisense; GAGGACGATGGCGTTATCCTGGCCT
>probe:Drosophila_2:1625743_at:293:253; Interrogation_Position=1861; Antisense; CAACGATCGCTATGTGGGCCTAATT
>probe:Drosophila_2:1625743_at:330:181; Interrogation_Position=1898; Antisense; AAAACGATGACCGAGCTGGGCCGTT
>probe:Drosophila_2:1625743_at:144:523; Interrogation_Position=1915; Antisense; GGGCCGTTGTGATTTCCATACCAAT
>probe:Drosophila_2:1625743_at:615:321; Interrogation_Position=1948; Antisense; GCCCAAGTGTCTCCATGGATGGTTT
>probe:Drosophila_2:1625743_at:213:591; Interrogation_Position=1967; Antisense; TGGTTTGCACCCAATGCCATTTAGA
>probe:Drosophila_2:1625743_at:287:345; Interrogation_Position=2042; Antisense; GCATCTGCCCAGTATTACGTTTAGA

Paste this into a BLAST search page for me
AAGCGGAGGCGTTTCAGGGCACCAAAACTGCGTCCGGAAATGCTGTGTGAGAACTACCGATACTTCTACGCGATTCTACGCGATTAGCTCCGATGTGGATTAAGAGCTGTCTAACCTGGTGCGAGGAGAATGTCTATCCCAGTGAGCCCAAGTGAGCCCATTTTTGTGCCTTCGCGAGGACGATGGCGTTATCCTGGCCTCAACGATCGCTATGTGGGCCTAATTAAAACGATGACCGAGCTGGGCCGTTGGGCCGTTGTGATTTCCATACCAATGCCCAAGTGTCTCCATGGATGGTTTTGGTTTGCACCCAATGCCATTTAGAGCATCTGCCCAGTATTACGTTTAGA

Full Affymetrix probeset data:

Annotations for 1625743_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime