FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625744_at:

>probe:Drosophila_2:1625744_at:515:611; Interrogation_Position=221; Antisense; TGACGGTCACTACATCTGGGATTCG
>probe:Drosophila_2:1625744_at:611:273; Interrogation_Position=251; Antisense; CATTATTGCCTATTTGGTCTCGAAA
>probe:Drosophila_2:1625744_at:614:529; Interrogation_Position=266; Antisense; GGTCTCGAAATATGCCGATTCCGAT
>probe:Drosophila_2:1625744_at:282:719; Interrogation_Position=284; Antisense; TTCCGATGCCCTATACCCGAAAGAT
>probe:Drosophila_2:1625744_at:304:393; Interrogation_Position=302; Antisense; GAAAGATCCTCTCAAGCGGGCTGTT
>probe:Drosophila_2:1625744_at:418:121; Interrogation_Position=334; Antisense; AGCGGCTGCACTTTGAATCCGGAGT
>probe:Drosophila_2:1625744_at:126:367; Interrogation_Position=348; Antisense; GAATCCGGAGTGGTCTTTGCCAATG
>probe:Drosophila_2:1625744_at:327:219; Interrogation_Position=390; Antisense; AAGTCAGTGCTCTTCCAGGGACAGA
>probe:Drosophila_2:1625744_at:554:671; Interrogation_Position=421; Antisense; TACCCAAGGAGCGATACGATGCCAT
>probe:Drosophila_2:1625744_at:111:611; Interrogation_Position=511; Antisense; TGACCATTGCGGATTTCAGTCTCGT
>probe:Drosophila_2:1625744_at:687:17; Interrogation_Position=523; Antisense; ATTTCAGTCTCGTTTCATCGGTGGC
>probe:Drosophila_2:1625744_at:77:307; Interrogation_Position=559; Antisense; CCTTCGTGGCCTTGGATACGACTAA
>probe:Drosophila_2:1625744_at:555:215; Interrogation_Position=582; Antisense; AAGTATCCCAGGATCGGTGCTTGGA
>probe:Drosophila_2:1625744_at:31:561; Interrogation_Position=617; Antisense; GGAACAGCTTCCATACTACGAGGAA

Paste this into a BLAST search page for me
TGACGGTCACTACATCTGGGATTCGCATTATTGCCTATTTGGTCTCGAAAGGTCTCGAAATATGCCGATTCCGATTTCCGATGCCCTATACCCGAAAGATGAAAGATCCTCTCAAGCGGGCTGTTAGCGGCTGCACTTTGAATCCGGAGTGAATCCGGAGTGGTCTTTGCCAATGAAGTCAGTGCTCTTCCAGGGACAGATACCCAAGGAGCGATACGATGCCATTGACCATTGCGGATTTCAGTCTCGTATTTCAGTCTCGTTTCATCGGTGGCCCTTCGTGGCCTTGGATACGACTAAAAGTATCCCAGGATCGGTGCTTGGAGGAACAGCTTCCATACTACGAGGAA

Full Affymetrix probeset data:

Annotations for 1625744_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720