Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625745_at:

>probe:Drosophila_2:1625745_at:177:39; Interrogation_Position=2352; Antisense; ATCCTTAATACCCAGTGAGTCCACA
>probe:Drosophila_2:1625745_at:696:621; Interrogation_Position=2393; Antisense; TGCTGCATCAGCTTCTTCAAAATGA
>probe:Drosophila_2:1625745_at:461:231; Interrogation_Position=2413; Antisense; AATGACAAGCATTTCCGCTGCAACC
>probe:Drosophila_2:1625745_at:346:661; Interrogation_Position=2442; Antisense; TACACCCTACGGCTACCAAATAGAC
>probe:Drosophila_2:1625745_at:141:403; Interrogation_Position=2464; Antisense; GACTTTGTGATACATTTCGATCGGG
>probe:Drosophila_2:1625745_at:390:277; Interrogation_Position=2510; Antisense; CTCCCGTGGAGGCAACCATGTTGGA
>probe:Drosophila_2:1625745_at:615:519; Interrogation_Position=2548; Antisense; GTGGCAATACTACTGCTCAAGCTCG
>probe:Drosophila_2:1625745_at:204:339; Interrogation_Position=2562; Antisense; GCTCAAGCTCGACTCTTTTTGTGAA
>probe:Drosophila_2:1625745_at:50:387; Interrogation_Position=2584; Antisense; GAAAACGATCTGACTGCATTGCGGG
>probe:Drosophila_2:1625745_at:388:199; Interrogation_Position=2668; Antisense; AACGAGCACGACTGGAACTCCAAGT
>probe:Drosophila_2:1625745_at:613:581; Interrogation_Position=2696; Antisense; TGGCGTCATCAACAGCCAAGGCCAA
>probe:Drosophila_2:1625745_at:607:577; Interrogation_Position=2715; Antisense; GGCCAACTACCTTAAATGCTTGTTA
>probe:Drosophila_2:1625745_at:717:341; Interrogation_Position=2754; Antisense; GCTTTCATTTCTATTCGTTGCGACG
>probe:Drosophila_2:1625745_at:330:469; Interrogation_Position=2770; Antisense; GTTGCGACGACATTACTCATAAGTA

Paste this into a BLAST search page for me
ATCCTTAATACCCAGTGAGTCCACATGCTGCATCAGCTTCTTCAAAATGAAATGACAAGCATTTCCGCTGCAACCTACACCCTACGGCTACCAAATAGACGACTTTGTGATACATTTCGATCGGGCTCCCGTGGAGGCAACCATGTTGGAGTGGCAATACTACTGCTCAAGCTCGGCTCAAGCTCGACTCTTTTTGTGAAGAAAACGATCTGACTGCATTGCGGGAACGAGCACGACTGGAACTCCAAGTTGGCGTCATCAACAGCCAAGGCCAAGGCCAACTACCTTAAATGCTTGTTAGCTTTCATTTCTATTCGTTGCGACGGTTGCGACGACATTACTCATAAGTA

Full Affymetrix probeset data:

Annotations for 1625745_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime