Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625746_at:

>probe:Drosophila_2:1625746_at:13:383; Interrogation_Position=1012; Antisense; GAACGAACGAGGAACTGCACCCATG
>probe:Drosophila_2:1625746_at:418:431; Interrogation_Position=1046; Antisense; GAGTCCTCCGAAGTTCTGGCCAGAT
>probe:Drosophila_2:1625746_at:161:265; Interrogation_Position=1066; Antisense; CAGATCCTGGGCTATCCAGTACGAG
>probe:Drosophila_2:1625746_at:661:259; Interrogation_Position=1102; Antisense; CACGCAACGGATTCTGGCACGAAAG
>probe:Drosophila_2:1625746_at:490:169; Interrogation_Position=1123; Antisense; AAAGGCCATCGCAGACATCCTGTTT
>probe:Drosophila_2:1625746_at:531:359; Interrogation_Position=1161; Antisense; GCAACCTGCGAGTAAACCGCGGCGA
>probe:Drosophila_2:1625746_at:265:421; Interrogation_Position=1192; Antisense; GAGCACCGTGGCAAATCATTTCTAA
>probe:Drosophila_2:1625746_at:242:257; Interrogation_Position=1208; Antisense; CATTTCTAAACCCTTGACTTCTACT
>probe:Drosophila_2:1625746_at:258:139; Interrogation_Position=1236; Antisense; ACGTCATTTGATATTCCTGCATTTG
>probe:Drosophila_2:1625746_at:178:307; Interrogation_Position=1251; Antisense; CCTGCATTTGTCACTCTACGATTTA
>probe:Drosophila_2:1625746_at:682:391; Interrogation_Position=1330; Antisense; GAAAGTTCGAAATCACTCAGGCCAT
>probe:Drosophila_2:1625746_at:264:603; Interrogation_Position=829; Antisense; TGATAACGCTTTCAACTACCAGTCC
>probe:Drosophila_2:1625746_at:354:471; Interrogation_Position=882; Antisense; GTTCCCTGCTCAGTCCAAAATTGGA
>probe:Drosophila_2:1625746_at:375:391; Interrogation_Position=976; Antisense; GAAAGAACCCACATCCTCGATTCAA

Paste this into a BLAST search page for me
GAACGAACGAGGAACTGCACCCATGGAGTCCTCCGAAGTTCTGGCCAGATCAGATCCTGGGCTATCCAGTACGAGCACGCAACGGATTCTGGCACGAAAGAAAGGCCATCGCAGACATCCTGTTTGCAACCTGCGAGTAAACCGCGGCGAGAGCACCGTGGCAAATCATTTCTAACATTTCTAAACCCTTGACTTCTACTACGTCATTTGATATTCCTGCATTTGCCTGCATTTGTCACTCTACGATTTAGAAAGTTCGAAATCACTCAGGCCATTGATAACGCTTTCAACTACCAGTCCGTTCCCTGCTCAGTCCAAAATTGGAGAAAGAACCCACATCCTCGATTCAA

Full Affymetrix probeset data:

Annotations for 1625746_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime