FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625747_at:

>probe:Drosophila_2:1625747_at:703:457; Interrogation_Position=2461; Antisense; GTTACTGTTTACTCGTTAAGACTTG
>probe:Drosophila_2:1625747_at:584:685; Interrogation_Position=2508; Antisense; TATTTCGAAATGATCCTTGCGGTAA
>probe:Drosophila_2:1625747_at:719:203; Interrogation_Position=2559; Antisense; AAGCCTCTGCGTATTATGCATTTGT
>probe:Drosophila_2:1625747_at:446:273; Interrogation_Position=2577; Antisense; CATTTGTATTTTTGCCTTGTTCATA
>probe:Drosophila_2:1625747_at:35:23; Interrogation_Position=2639; Antisense; ATATCACGCGATATCCATAACGTAT
>probe:Drosophila_2:1625747_at:648:687; Interrogation_Position=2673; Antisense; TATATAGTCTTTAGTAGGCCACCAT
>probe:Drosophila_2:1625747_at:710:69; Interrogation_Position=2688; Antisense; AGGCCACCATAAATCAATTGTCGAA
>probe:Drosophila_2:1625747_at:524:11; Interrogation_Position=2713; Antisense; ATTCGATTTGTTAGCCCAAGCCAGC
>probe:Drosophila_2:1625747_at:543:125; Interrogation_Position=2731; Antisense; AGCCAGCTCTCAATTGTTAATCCTT
>probe:Drosophila_2:1625747_at:213:515; Interrogation_Position=2789; Antisense; GTGTTTCCTTAATTTTTTGCATTGC
>probe:Drosophila_2:1625747_at:511:693; Interrogation_Position=2804; Antisense; TTTGCATTGCTCTTGAGTACGTTTT
>probe:Drosophila_2:1625747_at:412:507; Interrogation_Position=2817; Antisense; TGAGTACGTTTTGTTAACTTCTCCA
>probe:Drosophila_2:1625747_at:621:273; Interrogation_Position=2946; Antisense; CATTGAATTATCATTTCGCTGCGCG
>probe:Drosophila_2:1625747_at:453:335; Interrogation_Position=2963; Antisense; GCTGCGCGATGTACTTTACTTTGTA

Paste this into a BLAST search page for me
GTTACTGTTTACTCGTTAAGACTTGTATTTCGAAATGATCCTTGCGGTAAAAGCCTCTGCGTATTATGCATTTGTCATTTGTATTTTTGCCTTGTTCATAATATCACGCGATATCCATAACGTATTATATAGTCTTTAGTAGGCCACCATAGGCCACCATAAATCAATTGTCGAAATTCGATTTGTTAGCCCAAGCCAGCAGCCAGCTCTCAATTGTTAATCCTTGTGTTTCCTTAATTTTTTGCATTGCTTTGCATTGCTCTTGAGTACGTTTTTGAGTACGTTTTGTTAACTTCTCCACATTGAATTATCATTTCGCTGCGCGGCTGCGCGATGTACTTTACTTTGTA

Full Affymetrix probeset data:

Annotations for 1625747_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720