FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625749_at:

>probe:Drosophila_2:1625749_at:621:455; Interrogation_Position=1020; Antisense; GATACTGCGGCAGCTAGCCAGTCAA
>probe:Drosophila_2:1625749_at:274:533; Interrogation_Position=1048; Antisense; GGTGAGCTAACCGAACTCCATTTGT
>probe:Drosophila_2:1625749_at:639:33; Interrogation_Position=1079; Antisense; ATCAGTTGGAGAGTCCTTTGGGCCT
>probe:Drosophila_2:1625749_at:82:249; Interrogation_Position=1120; Antisense; AATTGTCGACAGCTGAGAGTCCTCG
>probe:Drosophila_2:1625749_at:407:145; Interrogation_Position=1150; Antisense; ACTCGAACCTTCTGCCATGGAGAAT
>probe:Drosophila_2:1625749_at:253:421; Interrogation_Position=1169; Antisense; GAGAATCCTTCGTCTGGAGGTGTAT
>probe:Drosophila_2:1625749_at:93:345; Interrogation_Position=1220; Antisense; GCATTCGCCCTCTAGAGCTGTGGAT
>probe:Drosophila_2:1625749_at:674:519; Interrogation_Position=1239; Antisense; GTGGATCCGGCATAGCGATATCAAT
>probe:Drosophila_2:1625749_at:608:241; Interrogation_Position=1269; Antisense; AATAGTTCAAAGTTCGCGCTGCGTT
>probe:Drosophila_2:1625749_at:337:447; Interrogation_Position=1329; Antisense; GATTGGACCCAATACGGACTACACA
>probe:Drosophila_2:1625749_at:229:549; Interrogation_Position=1344; Antisense; GGACTACACATCTGGCGTACTCAAG
>probe:Drosophila_2:1625749_at:105:177; Interrogation_Position=1385; Antisense; AAACCGCTGCCCCATGAGTGGGATA
>probe:Drosophila_2:1625749_at:369:83; Interrogation_Position=1401; Antisense; AGTGGGATATGCTCCAACTGATCAA
>probe:Drosophila_2:1625749_at:581:271; Interrogation_Position=1541; Antisense; CATTGTTTTTACTGCCCTTAGGGAT

Paste this into a BLAST search page for me
GATACTGCGGCAGCTAGCCAGTCAAGGTGAGCTAACCGAACTCCATTTGTATCAGTTGGAGAGTCCTTTGGGCCTAATTGTCGACAGCTGAGAGTCCTCGACTCGAACCTTCTGCCATGGAGAATGAGAATCCTTCGTCTGGAGGTGTATGCATTCGCCCTCTAGAGCTGTGGATGTGGATCCGGCATAGCGATATCAATAATAGTTCAAAGTTCGCGCTGCGTTGATTGGACCCAATACGGACTACACAGGACTACACATCTGGCGTACTCAAGAAACCGCTGCCCCATGAGTGGGATAAGTGGGATATGCTCCAACTGATCAACATTGTTTTTACTGCCCTTAGGGAT

Full Affymetrix probeset data:

Annotations for 1625749_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720