FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625750_at:

>probe:Drosophila_2:1625750_at:218:601; Interrogation_Position=182; Antisense; TGAGTGTTTTTATCTGTTCGCCCGT
>probe:Drosophila_2:1625750_at:75:321; Interrogation_Position=201; Antisense; GCCCGTTCGGGCCAAATCAACAATT
>probe:Drosophila_2:1625750_at:387:701; Interrogation_Position=241; Antisense; TTATTATGCGTTCTTTGGGTCTTTC
>probe:Drosophila_2:1625750_at:198:531; Interrogation_Position=257; Antisense; GGGTCTTTCGCCGACGATCCAAGAA
>probe:Drosophila_2:1625750_at:528:447; Interrogation_Position=272; Antisense; GATCCAAGAACTGGTTTCCTATCTG
>probe:Drosophila_2:1625750_at:459:589; Interrogation_Position=308; Antisense; TGGGAAAATGAGCTTCGCCGACTTC
>probe:Drosophila_2:1625750_at:155:37; Interrogation_Position=339; Antisense; ATCATGCATCAGCACTCCAAGGTGG
>probe:Drosophila_2:1625750_at:103:557; Interrogation_Position=374; Antisense; GGACGAGGTCATTGCCGCCTTTAAA
>probe:Drosophila_2:1625750_at:30:367; Interrogation_Position=413; Antisense; GAATAAGGGCACCATCTCGGCCAGA
>probe:Drosophila_2:1625750_at:177:579; Interrogation_Position=431; Antisense; GGCCAGACAGCTGCGTAATCTACTT
>probe:Drosophila_2:1625750_at:513:559; Interrogation_Position=491; Antisense; GGACAACATCTTCCGGGAGGCCAAT
>probe:Drosophila_2:1625750_at:315:675; Interrogation_Position=527; Antisense; TAGCACTGTGCGGTATGCAGACTTT
>probe:Drosophila_2:1625750_at:283:693; Interrogation_Position=549; Antisense; TTTGTCAAGATTGCATGCGCCCCAG
>probe:Drosophila_2:1625750_at:211:93; Interrogation_Position=572; Antisense; AGTTCCCGACTACTATTAGACTGCC

Paste this into a BLAST search page for me
TGAGTGTTTTTATCTGTTCGCCCGTGCCCGTTCGGGCCAAATCAACAATTTTATTATGCGTTCTTTGGGTCTTTCGGGTCTTTCGCCGACGATCCAAGAAGATCCAAGAACTGGTTTCCTATCTGTGGGAAAATGAGCTTCGCCGACTTCATCATGCATCAGCACTCCAAGGTGGGGACGAGGTCATTGCCGCCTTTAAAGAATAAGGGCACCATCTCGGCCAGAGGCCAGACAGCTGCGTAATCTACTTGGACAACATCTTCCGGGAGGCCAATTAGCACTGTGCGGTATGCAGACTTTTTTGTCAAGATTGCATGCGCCCCAGAGTTCCCGACTACTATTAGACTGCC

Full Affymetrix probeset data:

Annotations for 1625750_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720