FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625751_at:

>probe:Drosophila_2:1625751_at:522:609; Interrogation_Position=291; Antisense; TGCTCACTGGTTTACTTCCGGAAGA
>probe:Drosophila_2:1625751_at:158:547; Interrogation_Position=317; Antisense; GGAGGACCCGTGGAACGCCATAATT
>probe:Drosophila_2:1625751_at:243:525; Interrogation_Position=359; Antisense; GGGCATTCTTGCTGCTAGAACTGGA
>probe:Drosophila_2:1625751_at:278:677; Interrogation_Position=374; Antisense; TAGAACTGGACTAACCTCCATGCTC
>probe:Drosophila_2:1625751_at:609:265; Interrogation_Position=392; Antisense; CATGCTCAGTAGTGCCTTGGTGGGC
>probe:Drosophila_2:1625751_at:657:591; Interrogation_Position=454; Antisense; TGGTGTCCCATTATTCGGCGGATTC
>probe:Drosophila_2:1625751_at:377:115; Interrogation_Position=520; Antisense; AGCAGGAGCTTTTACGGCAGCAAAA
>probe:Drosophila_2:1625751_at:523:251; Interrogation_Position=537; Antisense; CAGCAAAAGGGCGTTTCTCCACTCG
>probe:Drosophila_2:1625751_at:165:311; Interrogation_Position=555; Antisense; CCACTCGCAGCGACTTATGGAGAGA
>probe:Drosophila_2:1625751_at:528:427; Interrogation_Position=576; Antisense; GAGATTGACTCTTCGGCATTGTAGA
>probe:Drosophila_2:1625751_at:212:727; Interrogation_Position=594; Antisense; TTGTAGAATTCTTCGCTGCGTCATC
>probe:Drosophila_2:1625751_at:477:45; Interrogation_Position=637; Antisense; ATCCGCGAACGCGTGGATCGACGAT
>probe:Drosophila_2:1625751_at:648:469; Interrogation_Position=694; Antisense; GTTCGAATCTGATACTGGCGGCATT
>probe:Drosophila_2:1625751_at:39:575; Interrogation_Position=710; Antisense; GGCGGCATTCCCATTTCAATTTAAA

Paste this into a BLAST search page for me
TGCTCACTGGTTTACTTCCGGAAGAGGAGGACCCGTGGAACGCCATAATTGGGCATTCTTGCTGCTAGAACTGGATAGAACTGGACTAACCTCCATGCTCCATGCTCAGTAGTGCCTTGGTGGGCTGGTGTCCCATTATTCGGCGGATTCAGCAGGAGCTTTTACGGCAGCAAAACAGCAAAAGGGCGTTTCTCCACTCGCCACTCGCAGCGACTTATGGAGAGAGAGATTGACTCTTCGGCATTGTAGATTGTAGAATTCTTCGCTGCGTCATCATCCGCGAACGCGTGGATCGACGATGTTCGAATCTGATACTGGCGGCATTGGCGGCATTCCCATTTCAATTTAAA

Full Affymetrix probeset data:

Annotations for 1625751_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720