FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625752_at:

>probe:Drosophila_2:1625752_at:168:551; Interrogation_Position=160; Antisense; GGAGCAAACTGCATTACTACGTAAT
>probe:Drosophila_2:1625752_at:404:619; Interrogation_Position=184; Antisense; TGCATTTAATGCTTTTGACCCTGAA
>probe:Drosophila_2:1625752_at:436:257; Interrogation_Position=226; Antisense; CACAGCTATGGTGGGTACGATACTT
>probe:Drosophila_2:1625752_at:526:671; Interrogation_Position=241; Antisense; TACGATACTTAGCATGTTGGGTCAT
>probe:Drosophila_2:1625752_at:348:359; Interrogation_Position=278; Antisense; GCAACTCTTGCTGACATTATCGCTG
>probe:Drosophila_2:1625752_at:685:637; Interrogation_Position=306; Antisense; TCGATGAGGATGGTTCGGGCCAAAT
>probe:Drosophila_2:1625752_at:39:17; Interrogation_Position=334; Antisense; ATTTGAAGAATTTACCACCCTGGCA
>probe:Drosophila_2:1625752_at:271:585; Interrogation_Position=354; Antisense; TGGCAGCCCGCTTCCTTGTGGAAGA
>probe:Drosophila_2:1625752_at:25:613; Interrogation_Position=405; Antisense; TGAAGGAAGCTTTCCGCCTTTACGA
>probe:Drosophila_2:1625752_at:445:687; Interrogation_Position=446; Antisense; TATATAACTACTGGTGTTCTTCGTG
>probe:Drosophila_2:1625752_at:344:395; Interrogation_Position=470; Antisense; GAAATCCTGCGCGAACTAGACGATA
>probe:Drosophila_2:1625752_at:715:611; Interrogation_Position=498; Antisense; TGACAAATGACGACCTGGACATGAT
>probe:Drosophila_2:1625752_at:161:305; Interrogation_Position=540; Antisense; CCGATGGATCGGGTACTGTTGATTT
>probe:Drosophila_2:1625752_at:646:87; Interrogation_Position=580; Antisense; AGTAATGACCGGTGGCGACGACTAA

Paste this into a BLAST search page for me
GGAGCAAACTGCATTACTACGTAATTGCATTTAATGCTTTTGACCCTGAACACAGCTATGGTGGGTACGATACTTTACGATACTTAGCATGTTGGGTCATGCAACTCTTGCTGACATTATCGCTGTCGATGAGGATGGTTCGGGCCAAATATTTGAAGAATTTACCACCCTGGCATGGCAGCCCGCTTCCTTGTGGAAGATGAAGGAAGCTTTCCGCCTTTACGATATATAACTACTGGTGTTCTTCGTGGAAATCCTGCGCGAACTAGACGATATGACAAATGACGACCTGGACATGATCCGATGGATCGGGTACTGTTGATTTAGTAATGACCGGTGGCGACGACTAA

Full Affymetrix probeset data:

Annotations for 1625752_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720