Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625754_s_at:

>probe:Drosophila_2:1625754_s_at:496:345; Interrogation_Position=388; Antisense; GCATTTTGCTCTTCCTGGCTGATAG
>probe:Drosophila_2:1625754_s_at:89:673; Interrogation_Position=410; Antisense; TAGCCATTGAACTGGTCTTCGTCAT
>probe:Drosophila_2:1625754_s_at:381:497; Interrogation_Position=424; Antisense; GTCTTCGTCATCTACTGGCAAATTG
>probe:Drosophila_2:1625754_s_at:22:247; Interrogation_Position=444; Antisense; AATTGAGTCCTTACAGATTGGCCTG
>probe:Drosophila_2:1625754_s_at:265:661; Interrogation_Position=455; Antisense; TACAGATTGGCCTGCAACGTTTTCT
>probe:Drosophila_2:1625754_s_at:496:359; Interrogation_Position=468; Antisense; GCAACGTTTTCTTGTGTTTTCCTGC
>probe:Drosophila_2:1625754_s_at:376:629; Interrogation_Position=518; Antisense; TCCTCCTCGTTAACAGCTACATTTG
>probe:Drosophila_2:1625754_s_at:424:335; Interrogation_Position=543; Antisense; GCTGCAGTCCATTTACGTAGTTATG
>probe:Drosophila_2:1625754_s_at:140:233; Interrogation_Position=630; Antisense; AATGAAGCTACACGGCATACTGCAG
>probe:Drosophila_2:1625754_s_at:361:459; Interrogation_Position=667; Antisense; GATATATCGCATTACTTCAGTGTGT
>probe:Drosophila_2:1625754_s_at:202:681; Interrogation_Position=695; Antisense; TATGTTCCGTAGTCGTTCTTCAATC
>probe:Drosophila_2:1625754_s_at:364:1; Interrogation_Position=720; Antisense; AGGCGTTTTCTATCGAGCTGTTTTT
>probe:Drosophila_2:1625754_s_at:518:707; Interrogation_Position=829; Antisense; TTACTCATTGGCACTATTCTCTTGG
>probe:Drosophila_2:1625754_s_at:145:11; Interrogation_Position=844; Antisense; ATTCTCTTGGTTGTTTGCGACTATA

Paste this into a BLAST search page for me
GCATTTTGCTCTTCCTGGCTGATAGTAGCCATTGAACTGGTCTTCGTCATGTCTTCGTCATCTACTGGCAAATTGAATTGAGTCCTTACAGATTGGCCTGTACAGATTGGCCTGCAACGTTTTCTGCAACGTTTTCTTGTGTTTTCCTGCTCCTCCTCGTTAACAGCTACATTTGGCTGCAGTCCATTTACGTAGTTATGAATGAAGCTACACGGCATACTGCAGGATATATCGCATTACTTCAGTGTGTTATGTTCCGTAGTCGTTCTTCAATCAGGCGTTTTCTATCGAGCTGTTTTTTTACTCATTGGCACTATTCTCTTGGATTCTCTTGGTTGTTTGCGACTATA

Full Affymetrix probeset data:

Annotations for 1625754_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime