FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625757_at:

>probe:Drosophila_2:1625757_at:390:61; Interrogation_Position=1020; Antisense; ATGTGCCCACAAAATTTTATGCGAT
>probe:Drosophila_2:1625757_at:325:247; Interrogation_Position=1048; Antisense; AATTGCAAGTCGAACTGGAGGTCAA
>probe:Drosophila_2:1625757_at:323:563; Interrogation_Position=1166; Antisense; GGCAAGAATCCCTTTAAATCAACCT
>probe:Drosophila_2:1625757_at:99:557; Interrogation_Position=1203; Antisense; GGACTAATCAACCTGTGTTTATCAT
>probe:Drosophila_2:1625757_at:320:219; Interrogation_Position=654; Antisense; CAAGTGGTACGAAACCTTCAAGGTG
>probe:Drosophila_2:1625757_at:40:709; Interrogation_Position=670; Antisense; TTCAAGGTGGAATACCCGCAGCTGT
>probe:Drosophila_2:1625757_at:592:303; Interrogation_Position=685; Antisense; CCGCAGCTGTGGGAGATCGCCAACA
>probe:Drosophila_2:1625757_at:94:313; Interrogation_Position=703; Antisense; GCCAACAGCGGCATGCAGGAGATAA
>probe:Drosophila_2:1625757_at:50:87; Interrogation_Position=727; Antisense; AGTGCGTTTGAGCAGAACCCACCGG
>probe:Drosophila_2:1625757_at:465:381; Interrogation_Position=741; Antisense; GAACCCACCGGATATGTCACACATG
>probe:Drosophila_2:1625757_at:119:411; Interrogation_Position=783; Antisense; GACGCGCAAGTCTATGGGCCTGAAG
>probe:Drosophila_2:1625757_at:556:705; Interrogation_Position=823; Antisense; TTAGAACTTAAGACCCTGCCAGCAA
>probe:Drosophila_2:1625757_at:240:471; Interrogation_Position=862; Antisense; GTTCTCCTTTTAATTCTTGTGAAAT
>probe:Drosophila_2:1625757_at:589:541; Interrogation_Position=953; Antisense; GGTTGTTTTGCCTTCCAAATTGACA

Paste this into a BLAST search page for me
ATGTGCCCACAAAATTTTATGCGATAATTGCAAGTCGAACTGGAGGTCAAGGCAAGAATCCCTTTAAATCAACCTGGACTAATCAACCTGTGTTTATCATCAAGTGGTACGAAACCTTCAAGGTGTTCAAGGTGGAATACCCGCAGCTGTCCGCAGCTGTGGGAGATCGCCAACAGCCAACAGCGGCATGCAGGAGATAAAGTGCGTTTGAGCAGAACCCACCGGGAACCCACCGGATATGTCACACATGGACGCGCAAGTCTATGGGCCTGAAGTTAGAACTTAAGACCCTGCCAGCAAGTTCTCCTTTTAATTCTTGTGAAATGGTTGTTTTGCCTTCCAAATTGACA

Full Affymetrix probeset data:

Annotations for 1625757_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720