Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625759_at:

>probe:Drosophila_2:1625759_at:509:493; Interrogation_Position=1961; Antisense; GTAATGCCACTGAGCGAGATGCCCG
>probe:Drosophila_2:1625759_at:692:425; Interrogation_Position=1976; Antisense; GAGATGCCCGCTTTCAGGCGCTGGC
>probe:Drosophila_2:1625759_at:661:455; Interrogation_Position=2005; Antisense; GATACCCGCGTGGTGATCATCACAC
>probe:Drosophila_2:1625759_at:659:271; Interrogation_Position=2022; Antisense; CATCACACTGCTGCAGCGCAGGAAA
>probe:Drosophila_2:1625759_at:144:191; Interrogation_Position=2050; Antisense; AACATCGGGCAACTGGGCGAGCTCA
>probe:Drosophila_2:1625759_at:237:261; Interrogation_Position=2076; Antisense; CACCCTGTACCGACAGAGCTGTATA
>probe:Drosophila_2:1625759_at:78:483; Interrogation_Position=2096; Antisense; GTATAGACTTCAACACCTTTTTGGA
>probe:Drosophila_2:1625759_at:88:365; Interrogation_Position=2119; Antisense; GAATACGACAAGTTCGCTGAGGAGC
>probe:Drosophila_2:1625759_at:576:107; Interrogation_Position=2147; Antisense; AGAAGATCGCGCTGGCCAAGAATCG
>probe:Drosophila_2:1625759_at:400:367; Interrogation_Position=2166; Antisense; GAATCGCAGCGAATTCTGGCAAGAC
>probe:Drosophila_2:1625759_at:172:65; Interrogation_Position=2194; Antisense; ATGGTCGACAAGCAATTGGGCCCTT
>probe:Drosophila_2:1625759_at:293:247; Interrogation_Position=2207; Antisense; AATTGGGCCCTTTGGTGCTTGGCGA
>probe:Drosophila_2:1625759_at:471:411; Interrogation_Position=2235; Antisense; GACGCTGGACGACGAATTGGCTCTA
>probe:Drosophila_2:1625759_at:384:183; Interrogation_Position=2259; Antisense; AAAAGCCTATTACACCATCGAGAAT

Paste this into a BLAST search page for me
GTAATGCCACTGAGCGAGATGCCCGGAGATGCCCGCTTTCAGGCGCTGGCGATACCCGCGTGGTGATCATCACACCATCACACTGCTGCAGCGCAGGAAAAACATCGGGCAACTGGGCGAGCTCACACCCTGTACCGACAGAGCTGTATAGTATAGACTTCAACACCTTTTTGGAGAATACGACAAGTTCGCTGAGGAGCAGAAGATCGCGCTGGCCAAGAATCGGAATCGCAGCGAATTCTGGCAAGACATGGTCGACAAGCAATTGGGCCCTTAATTGGGCCCTTTGGTGCTTGGCGAGACGCTGGACGACGAATTGGCTCTAAAAAGCCTATTACACCATCGAGAAT

Full Affymetrix probeset data:

Annotations for 1625759_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime