FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625760_at:

>probe:Drosophila_2:1625760_at:664:245; Interrogation_Position=1009; Antisense; AATTCGATAGCGTTCTTTGTGCCCG
>probe:Drosophila_2:1625760_at:293:569; Interrogation_Position=1083; Antisense; GGCAGTTGTGCTGATGTGCGCCAAT
>probe:Drosophila_2:1625760_at:654:199; Interrogation_Position=1117; Antisense; AACGCTGGTTCCACCATTGGTAGTA
>probe:Drosophila_2:1625760_at:142:249; Interrogation_Position=1167; Antisense; CAATCACGCTGGCATTCTTATGGGA
>probe:Drosophila_2:1625760_at:335:329; Interrogation_Position=1204; Antisense; GCGTCTAACATTGTGCCCATTTTGA
>probe:Drosophila_2:1625760_at:78:611; Interrogation_Position=1226; Antisense; TGACGCCCCTTCTTGTGGGAATCAT
>probe:Drosophila_2:1625760_at:679:317; Interrogation_Position=1303; Antisense; GCCGTTATCTTCTGTGTGGGCAACA
>probe:Drosophila_2:1625760_at:618:517; Interrogation_Position=1318; Antisense; GTGGGCAACATTGTCTACGTAGCTT
>probe:Drosophila_2:1625760_at:88:441; Interrogation_Position=1350; Antisense; GATGGTTAATCAGCCCTGGGATGCA
>probe:Drosophila_2:1625760_at:123:547; Interrogation_Position=1368; Antisense; GGATGCACCCGACTTTATGGATAAG
>probe:Drosophila_2:1625760_at:717:529; Interrogation_Position=923; Antisense; GGGTTATGGCCTTTGTCTATCTAAT
>probe:Drosophila_2:1625760_at:619:655; Interrogation_Position=944; Antisense; TAATCATCGCGGATATCCTGCTGAC
>probe:Drosophila_2:1625760_at:673:609; Interrogation_Position=965; Antisense; TGACCAGAGGCATCATGTCCATCAC
>probe:Drosophila_2:1625760_at:223:505; Interrogation_Position=981; Antisense; GTCCATCACTGGCATTCGCAAGAGT

Paste this into a BLAST search page for me
AATTCGATAGCGTTCTTTGTGCCCGGGCAGTTGTGCTGATGTGCGCCAATAACGCTGGTTCCACCATTGGTAGTACAATCACGCTGGCATTCTTATGGGAGCGTCTAACATTGTGCCCATTTTGATGACGCCCCTTCTTGTGGGAATCATGCCGTTATCTTCTGTGTGGGCAACAGTGGGCAACATTGTCTACGTAGCTTGATGGTTAATCAGCCCTGGGATGCAGGATGCACCCGACTTTATGGATAAGGGGTTATGGCCTTTGTCTATCTAATTAATCATCGCGGATATCCTGCTGACTGACCAGAGGCATCATGTCCATCACGTCCATCACTGGCATTCGCAAGAGT

Full Affymetrix probeset data:

Annotations for 1625760_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720