Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625762_s_at:

>probe:Drosophila_2:1625762_s_at:61:113; Interrogation_Position=100; Antisense; AGCAGCCAGGTGTCCTCCACATCAA
>probe:Drosophila_2:1625762_s_at:514:141; Interrogation_Position=160; Antisense; ACGGCTGCTACGACAACAACTGATT
>probe:Drosophila_2:1625762_s_at:201:669; Interrogation_Position=168; Antisense; TACGACAACAACTGATTCGTCCACC
>probe:Drosophila_2:1625762_s_at:597:261; Interrogation_Position=219; Antisense; CACCACTGCCTCCACAAAGAAGAAG
>probe:Drosophila_2:1625762_s_at:98:173; Interrogation_Position=234; Antisense; AAAGAAGAAGCACCGACGCCGCCGT
>probe:Drosophila_2:1625762_s_at:110:211; Interrogation_Position=238; Antisense; AAGAAGCACCGACGCCGCCGTGTCA
>probe:Drosophila_2:1625762_s_at:301:317; Interrogation_Position=254; Antisense; GCCGTGTCATCATCAGGCGCGTGAT
>probe:Drosophila_2:1625762_s_at:233:515; Interrogation_Position=257; Antisense; GTGTCATCATCAGGCGCGTGATCAT
>probe:Drosophila_2:1625762_s_at:558:35; Interrogation_Position=265; Antisense; ATCAGGCGCGTGATCATCCGCCGTG
>probe:Drosophila_2:1625762_s_at:76:37; Interrogation_Position=277; Antisense; ATCATCCGCCGTGGCAGGGAAGGAC
>probe:Drosophila_2:1625762_s_at:675:83; Interrogation_Position=304; Antisense; AGTGAGAGCGGAGACAATCGCCGAC
>probe:Drosophila_2:1625762_s_at:698:579; Interrogation_Position=71; Antisense; TGGCCGTCCTGGTCGTTCTGATCCT
>probe:Drosophila_2:1625762_s_at:429:591; Interrogation_Position=80; Antisense; TGGTCGTTCTGATCCTCCACAGCAG
>probe:Drosophila_2:1625762_s_at:258:285; Interrogation_Position=88; Antisense; CTGATCCTCCACAGCAGCCAGGTGT

Paste this into a BLAST search page for me
AGCAGCCAGGTGTCCTCCACATCAAACGGCTGCTACGACAACAACTGATTTACGACAACAACTGATTCGTCCACCCACCACTGCCTCCACAAAGAAGAAGAAAGAAGAAGCACCGACGCCGCCGTAAGAAGCACCGACGCCGCCGTGTCAGCCGTGTCATCATCAGGCGCGTGATGTGTCATCATCAGGCGCGTGATCATATCAGGCGCGTGATCATCCGCCGTGATCATCCGCCGTGGCAGGGAAGGACAGTGAGAGCGGAGACAATCGCCGACTGGCCGTCCTGGTCGTTCTGATCCTTGGTCGTTCTGATCCTCCACAGCAGCTGATCCTCCACAGCAGCCAGGTGT

Full Affymetrix probeset data:

Annotations for 1625762_s_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime