FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625763_at:

>probe:Drosophila_2:1625763_at:33:65; Interrogation_Position=269; Antisense; ATGTGGATCTCCTTGTACGCGGGAA
>probe:Drosophila_2:1625763_at:383:141; Interrogation_Position=300; Antisense; ACGGCTCCTACCTGGTGTGGCGTGA
>probe:Drosophila_2:1625763_at:222:351; Interrogation_Position=421; Antisense; GCAGCACAACATCAAGGGCGGCCTT
>probe:Drosophila_2:1625763_at:371:7; Interrogation_Position=446; Antisense; ATTGACATAGTTGCACTCACGGCCG
>probe:Drosophila_2:1625763_at:497:331; Interrogation_Position=483; Antisense; GCGGCGTTCTGTTCTACCGAGTGAA
>probe:Drosophila_2:1625763_at:131:387; Interrogation_Position=505; Antisense; GAACAAGACCGCTGGATTGCTCTTC
>probe:Drosophila_2:1625763_at:364:593; Interrogation_Position=549; Antisense; TGGGATTCGCGACGGCTCTGAACTA
>probe:Drosophila_2:1625763_at:538:313; Interrogation_Position=575; Antisense; GCCATCTGGAAGCTGAACCCGGAGA
>probe:Drosophila_2:1625763_at:575:111; Interrogation_Position=635; Antisense; AGCAGCCACGCTAAGTCGAGTTAAG
>probe:Drosophila_2:1625763_at:491:87; Interrogation_Position=680; Antisense; AGTAATTTTGGGTGTCTTTCATGCA
>probe:Drosophila_2:1625763_at:436:265; Interrogation_Position=699; Antisense; CATGCAAATTGCAGGGCTTTCCGAC
>probe:Drosophila_2:1625763_at:547:695; Interrogation_Position=716; Antisense; TTTCCGACCTATCGAACCAGGGCTG
>probe:Drosophila_2:1625763_at:573:41; Interrogation_Position=759; Antisense; ATCGATAAGCAGTGCCTCCAATGGG
>probe:Drosophila_2:1625763_at:631:483; Interrogation_Position=798; Antisense; GTATCATATGCTGCTGCACGTTCAA

Paste this into a BLAST search page for me
ATGTGGATCTCCTTGTACGCGGGAAACGGCTCCTACCTGGTGTGGCGTGAGCAGCACAACATCAAGGGCGGCCTTATTGACATAGTTGCACTCACGGCCGGCGGCGTTCTGTTCTACCGAGTGAAGAACAAGACCGCTGGATTGCTCTTCTGGGATTCGCGACGGCTCTGAACTAGCCATCTGGAAGCTGAACCCGGAGAAGCAGCCACGCTAAGTCGAGTTAAGAGTAATTTTGGGTGTCTTTCATGCACATGCAAATTGCAGGGCTTTCCGACTTTCCGACCTATCGAACCAGGGCTGATCGATAAGCAGTGCCTCCAATGGGGTATCATATGCTGCTGCACGTTCAA

Full Affymetrix probeset data:

Annotations for 1625763_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720