FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625764_at:

>probe:Drosophila_2:1625764_at:459:347; Interrogation_Position=1111; Antisense; GCAAGGACGTCTGCCAAGGATTCGG
>probe:Drosophila_2:1625764_at:203:553; Interrogation_Position=1137; Antisense; GGAGCACCGCTTTTCATACAAGAGA
>probe:Drosophila_2:1625764_at:422:383; Interrogation_Position=1160; Antisense; GAACGGCATCTTTTCACAGATCGGC
>probe:Drosophila_2:1625764_at:577:153; Interrogation_Position=1175; Antisense; ACAGATCGGCATCATGTCCTTTGGA
>probe:Drosophila_2:1625764_at:580:723; Interrogation_Position=1195; Antisense; TTGGATCTGATAACTGCGGCGGTCT
>probe:Drosophila_2:1625764_at:606:433; Interrogation_Position=1260; Antisense; GAGTGGATTCACGACAACACGCCGC
>probe:Drosophila_2:1625764_at:37:455; Interrogation_Position=717; Antisense; GATACTAGTAGCGATCCGGACTGCG
>probe:Drosophila_2:1625764_at:521:61; Interrogation_Position=790; Antisense; ATGTGATCGTGCATCCCGACTACAA
>probe:Drosophila_2:1625764_at:663:81; Interrogation_Position=817; Antisense; AGGGCCAGTATCACCATGACATTGC
>probe:Drosophila_2:1625764_at:722:55; Interrogation_Position=832; Antisense; ATGACATTGCTCTGCTGGTGCTTAA
>probe:Drosophila_2:1625764_at:333:331; Interrogation_Position=845; Antisense; GCTGGTGCTTAAAACGCCGCTAAAC
>probe:Drosophila_2:1625764_at:253:297; Interrogation_Position=862; Antisense; CGCTAAACTATTCGGTGGCTACACA
>probe:Drosophila_2:1625764_at:84:213; Interrogation_Position=903; Antisense; AAGACACGCGCCAACCTGGTGGTGG
>probe:Drosophila_2:1625764_at:474:361; Interrogation_Position=955; Antisense; GCAAGATGTCCACGTCGAGTGTCCG

Paste this into a BLAST search page for me
GCAAGGACGTCTGCCAAGGATTCGGGGAGCACCGCTTTTCATACAAGAGAGAACGGCATCTTTTCACAGATCGGCACAGATCGGCATCATGTCCTTTGGATTGGATCTGATAACTGCGGCGGTCTGAGTGGATTCACGACAACACGCCGCGATACTAGTAGCGATCCGGACTGCGATGTGATCGTGCATCCCGACTACAAAGGGCCAGTATCACCATGACATTGCATGACATTGCTCTGCTGGTGCTTAAGCTGGTGCTTAAAACGCCGCTAAACCGCTAAACTATTCGGTGGCTACACAAAGACACGCGCCAACCTGGTGGTGGGCAAGATGTCCACGTCGAGTGTCCG

Full Affymetrix probeset data:

Annotations for 1625764_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720